,Photoshop 3.08BIM,,bhttp://ns.adobe.com/xap/1.0/ image/jpeg Bocetos_paneles 2019-01-29T12:07:35+01:00 2019-01-29T11:07:37Z 2019-01-29T12:07:35+01:00 Adobe Illustrator CC 22.1 (Windows) 256 28 JPEG /9j/4AAQSkZJRgABAgEBLAEsAAD/7QAsUGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABABLAAAAAEA AQEsAAAAAQAB/+4ADkFkb2JlAGTAAAAAAf/bAIQABgQEBAUEBgUFBgkGBQYJCwgGBggLDAoKCwoK DBAMDAwMDAwQDA4PEA8ODBMTFBQTExwbGxscHx8fHx8fHx8fHwEHBwcNDA0YEBAYGhURFRofHx8f Hx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8f/8AAEQgAHAEAAwER AAIRAQMRAf/EAaIAAAAHAQEBAQEAAAAAAAAAAAQFAwIGAQAHCAkKCwEAAgIDAQEBAQEAAAAAAAAA AQACAwQFBgcICQoLEAACAQMDAgQCBgcDBAIGAnMBAgMRBAAFIRIxQVEGE2EicYEUMpGhBxWxQiPB UtHhMxZi8CRygvElQzRTkqKyY3PCNUQnk6OzNhdUZHTD0uIIJoMJChgZhJRFRqS0VtNVKBry4/PE 1OT0ZXWFlaW1xdXl9WZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo+Ck5SVlpeYmZ qbnJ2en5KjpKWmp6ipqqusra6voRAAICAQIDBQUEBQYECAMDbQEAAhEDBCESMUEFURNhIgZxgZEy obHwFMHR4SNCFVJicvEzJDRDghaSUyWiY7LCB3PSNeJEgxdUkwgJChgZJjZFGidkdFU38qOzwygp 0+PzhJSktMTU5PRldYWVpbXF1eX1RlZmdoaWprbG1ub2R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo +DlJWWl5iZmpucnZ6fkqOkpaanqKmqq6ytrq+v/aAAwDAQACEQMRAD8A9U4q7FXYq7FXYq7FXYq7 FXYq7FXYq7FXYq7FXYq41oadcVeWWn5j+epfWmm0y3isoSI1neC6V3f0jI7GAFnSNeBXl8VSR03p gQ1Upd1rjkJXtIDzFftZz5evrjXvLFvdXqm3lvEcyLbu0ZUB2C8XRiQeIFeLdehzMxy4o2kiiwLz bL5l0PzNFBob32oKyxOkNxPevBHQuzyM6uVkOyj0T9ofPfFy6iUZ1tS3yFE/cPj+jmynyr5j1TXZ 7qw1ewigRYpPVgcUZlL+mKxM0lUdQ27Ur2BWjG2GQmVHuTKIp35oebbnyv5bTULeT0pZblLYTGJJ 1TmrnkyPLbinw/z5ZkJA2/H3oixjRPPnma60N9Rne4uUYyFbi2ihiiVSP3TOZIn4o1GLMhlCADdm amVxySPP8f2LYeq5kIeXXH5j+dm8x6paW+lwWui6c8sAvr6KSKSWZHZB6KNNH6ybB+SbkV4gmlcU ZjxVtf6PNlTO/L+qvrGnS3DmP0ndkgkt5OQaMqpDckLAN8X7LGnjlmDIZA33/jqVkKYX5903WdO9 EaFPqc8snFzH+kZUSiuA6s8shI5KSRRTv4ZRqc8oSFGgu9WAZe6v0kJj5U89apqep22mXFrRi0yX FxICtREnINGVAVwzdNl+Gh+1yVZ4sxJAJHy/aylFOPN2nJ+jrvU0nvlntoi4hs7idOQQV4rFG6qW PbapOXZpERJDWwHyh5180WFuYbuGa4FzchLc6jOWuEQ/u0lkjYLJGspjLcfipvTtyxIaiR2sGXu+ 7dnGiLoj37PUfQ/SelQfWWkhaZI5JPq0skRDFQSFkQo9K5mwlxRB72JFF5dquv61pHmYWdn+kUWK 4W2Wa6NzcQMea0POS4+rn10k9NeX7ZFODBuOIc8+Mj0/pZAeRZ15N8yX+rteQXxtjc2PppOLb1E4 ykusiNHKfUUAx/CWpUdgQcyMcybtEgEePNvlT/q82P8A0kw/81ZaxTVWVlDKQVIqCNwQcVbxV2Ku xV2KuxV2KuxV2KuxV2KuxV2KuxV2KscT8vPKYhlhe2mnSaMRP9Yu7udgoNfgaWV2Q1oSVIJoP5RS j8tj7ljtfn37/emmnaNZ6Ro66ZpEf1a3hVxbIWZwrOS/2pC7faau9curbZSbYrq3kPVtXunuNQvv VZ4fTMazSxRVUsVrFGFjdaleSurch8J2NMolg4jZ5tdSsb8kTbeQPqMIm0W9Oi6pICLm5t19aJlJ UlVt5iYVrwWpVAeu+5yUMIjy5thlIiinOveVdF8x6THpnmCAahboySspLxAyoCOf7tlI+0dq5bSh DJ5A8pR6emnxWHp2kYURxpLMhXjGY1IZXDAqGqDXZgG+0oIBiD0UbMgySsfn8heVri7kurq0kupJ HeUpcXFzPEJHbmWSGSRokIP2eKjiNloDlMtPA9ExJBJBO/45ckd5f8t6N5esP0fo9v8AVbPm0gh5 ySAMwANPUZyBt0G2WRgI8llInmx3WfJmu6zNG9/qBKRh0WOCea2+B+tWtxExbbYk7dsqnh4udFqI l39V0H5fenBFcQXX1DXbVWis9SgHqLFEw4kC3fjASR4x/qGOPAIbjm2cUiKKYapofmO805dPOph4 3hMV5ccVhkkJJ+JeCtwPHup+VMsILAgpPo/5aQWkclpct6mnXJaS6gW4uCzStSrK5IccqDkOVCam lS1afyw4hI8wnFxQFXt8/vTnT9B8wadBcQw6ybmDgsem200Mai2VKBV9QBpJKIKVepPjl1GtlNpF d/l1qV4t6t3e/WPrsizSmSeY8ZEcSL6YpSNeQ6JT8BlJ044uLqxqVEXz/G3d8EZpn5cw6HIJPLF5 +glnZJNUt4YVniuHQUXaUn0gASP3YXag6AZbGFdWwklLPzX0+0uUsYP0rDpCqJZboERh3RvTjDci yFKfZD+JGYusJFUL5/oUg8+IRSby/q17Z+YdKF9Pc/VJSQJ5JYVt2iit2kM7kXE1aVCkKiD9relT HDw7AHcVfx6bttSrd6jfv9b0e7NlKrtJBKsMqfvF58So+yRWjdgczM30H3FrDyVNI81RvfCCW5nj 9VmuD6FwsSu6AFFjYyu0afbIiNSxp16YEL4aIlf45/2M43fMEfL8fN6zoJnOh6cbh3knNtCZZJI2 idn9McmaN/iQk9VO46ZsYcgwPN53590XXbvXbyaxstTnZlRbaeBNPa3QiEdPrH7zjz+1tWvTbNdm xk5brb/O/RsygSL5/wCxr9fzT78vLf0rnU/Uiu4rkiBZlu4ym6B15KwjjjJcgueJbqN6EAZWniRd j8fjoiRtmmZLF2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxVhVz /gH6zL6tPW4Hn/q1Nfp6++UnhaDwJhZf4M/Q93/c/oriv1v6xx9Lj258tvvyUeFnHhpNtC/Qf6Mi /Qfofo3f0vqvH0q1+KnHbrkxXRmK6I/Cl2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2KuxV2Ku xV2KuxV2KuxV2KuxV2KuxV2KuxV//9k= xmp.iid:bd8cfccf-f5c7-ab47-8688-69787c6a5964 xmp.did:bd8cfccf-f5c7-ab47-8688-69787c6a5964 uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf 1 uuid:0e10cdef-b208-440a-b236-f3ec8528849c xmp.did:ae790212-9a9a-1f42-83dd-cf4dfa6bddbc uuid:5D20892493BFDB11914A8590D31508C8 1 proof:pdf saved xmp.iid:947A6F18D3C3E4119FD4EB60A9435958 2015-03-06T10:50:40+01:00 Adobe Illustrator CS5.1 / saved xmp.iid:bd8cfccf-f5c7-ab47-8688-69787c6a5964 2019-01-29T12:07:35+01:00 Adobe Illustrator CC 22.1 (Windows) / EmbedByReference K:\PROYECTOS\RED_la Puebla de Cazalla\Diseños\Definitivos\Datos_cambios paneles_La Puebla\Bocetos_paneles_mod_oct2018.pdf xmp.did:ae790212-9a9a-1f42-83dd-cf4dfa6bddbc uuid:0e10cdef-b208-440a-b236-f3ec8528849c EmbedByReference K:\PROYECTOS\RED_la Puebla de Cazalla\Diseños\Definitivos\Datos_cambios paneles_La Puebla\Bocetos_paneles_mod_oct2018.pdf xmp.did:ae790212-9a9a-1f42-83dd-cf4dfa6bddbc uuid:0e10cdef-b208-440a-b236-f3ec8528849c EmbedByReference K:\PROYECTOS\RED_la Puebla de Cazalla\Diseños\Definitivos\Datos_cambios paneles_La Puebla\Bocetos_paneles_mod_oct2018.pdf xmp.did:ae790212-9a9a-1f42-83dd-cf4dfa6bddbc uuid:0e10cdef-b208-440a-b236-f3ec8528849c EmbedByReference K:\PROYECTOS\RED_la Puebla de Cazalla\Diseños\Definitivos\Datos_cambios paneles_La Puebla\Bocetos_paneles_mod_oct2018.pdf xmp.did:ae790212-9a9a-1f42-83dd-cf4dfa6bddbc uuid:0e10cdef-b208-440a-b236-f3ec8528849c EmbedByReference K:\PROYECTOS\RED_la Puebla de Cazalla\Diseños\Definitivos\Datos_cambios paneles_La Puebla\Bocetos_paneles_mod_oct2018.pdf xmp.did:ae790212-9a9a-1f42-83dd-cf4dfa6bddbc uuid:0e10cdef-b208-440a-b236-f3ec8528849c EmbedByReference K:\PROYECTOS\RED_la Puebla de Cazalla\Diseños\Definitivos\Datos_cambios paneles_La Puebla\Bocetos_paneles_mod_oct2018.pdf xmp.did:ae790212-9a9a-1f42-83dd-cf4dfa6bddbc uuid:0e10cdef-b208-440a-b236-f3ec8528849c EmbedByReference K:\PROYECTOS\RED_la Puebla de Cazalla\Diseños\Definitivos\Datos_cambios paneles_La Puebla\Bocetos_paneles_mod_oct2018.pdf xmp.did:ae790212-9a9a-1f42-83dd-cf4dfa6bddbc uuid:0e10cdef-b208-440a-b236-f3ec8528849c EmbedByReference K:\PROYECTOS\RED_la Puebla de Cazalla\Diseños\Definitivos\Datos_cambios paneles_La Puebla\Bocetos_paneles_mod_oct2018.pdf xmp.did:ae790212-9a9a-1f42-83dd-cf4dfa6bddbc uuid:0e10cdef-b208-440a-b236-f3ec8528849c EmbedByReference K:\PROYECTOS\RED_la Puebla de Cazalla\Diseños\Definitivos\Datos_cambios paneles_La Puebla\Bocetos_paneles_mod_oct2018.pdf xmp.did:ae790212-9a9a-1f42-83dd-cf4dfa6bddbc uuid:0e10cdef-b208-440a-b236-f3ec8528849c EmbedByReference K:\PROYECTOS\RED_la Puebla de Cazalla\Diseños\Definitivos\Datos_cambios paneles_La Puebla\Bocetos_paneles_mod_oct2018.pdf xmp.did:ae790212-9a9a-1f42-83dd-cf4dfa6bddbc uuid:0e10cdef-b208-440a-b236-f3ec8528849c K:\PROYECTOS\RED_la Puebla de Cazalla\Diseños\Definitivos\Datos_cambios paneles_La Puebla\Bocetos_paneles_mod_oct2018.pdf xmp.did:ae790212-9a9a-1f42-83dd-cf4dfa6bddbc uuid:0e10cdef-b208-440a-b236-f3ec8528849c K:\PROYECTOS\RED_la Puebla de Cazalla\Diseños\Definitivos\Datos_cambios paneles_La Puebla\Bocetos_paneles_mod_oct2018.pdf xmp.did:ae790212-9a9a-1f42-83dd-cf4dfa6bddbc uuid:0e10cdef-b208-440a-b236-f3ec8528849c K:\PROYECTOS\RED_la Puebla de Cazalla\Diseños\Definitivos\Datos_cambios paneles_La Puebla\Bocetos_paneles_mod_oct2018.pdf xmp.did:ae790212-9a9a-1f42-83dd-cf4dfa6bddbc uuid:0e10cdef-b208-440a-b236-f3ec8528849c K:\PROYECTOS\RED_la Puebla de Cazalla\Diseños\Definitivos\Datos_cambios paneles_La Puebla\Bocetos_paneles_mod_oct2018.pdf xmp.did:ae790212-9a9a-1f42-83dd-cf4dfa6bddbc uuid:0e10cdef-b208-440a-b236-f3ec8528849c K:\PROYECTOS\RED_la Puebla de Cazalla\Diseños\Definitivos\Datos_cambios paneles_La Puebla\Bocetos_paneles_mod_oct2018.pdf xmp.did:ae790212-9a9a-1f42-83dd-cf4dfa6bddbc uuid:0e10cdef-b208-440a-b236-f3ec8528849c K:\PROYECTOS\RED_la Puebla de Cazalla\Diseños\Definitivos\Datos_cambios paneles_La Puebla\Bocetos_paneles_mod_oct2018.pdf xmp.did:ae790212-9a9a-1f42-83dd-cf4dfa6bddbc uuid:0e10cdef-b208-440a-b236-f3ec8528849c K:\PROYECTOS\RED_la Puebla de Cazalla\Diseños\Definitivos\Datos_cambios paneles_La Puebla\Bocetos_paneles_mod_oct2018.pdf xmp.did:ae790212-9a9a-1f42-83dd-cf4dfa6bddbc uuid:0e10cdef-b208-440a-b236-f3ec8528849c K:\PROYECTOS\RED_la Puebla de Cazalla\Diseños\Definitivos\Datos_cambios paneles_La Puebla\Bocetos_paneles_mod_oct2018.pdf xmp.did:ae790212-9a9a-1f42-83dd-cf4dfa6bddbc uuid:0e10cdef-b208-440a-b236-f3ec8528849c K:\PROYECTOS\RED_la Puebla de Cazalla\Diseños\Definitivos\Datos_cambios paneles_La Puebla\Bocetos_paneles_mod_oct2018.pdf xmp.did:ae790212-9a9a-1f42-83dd-cf4dfa6bddbc uuid:0e10cdef-b208-440a-b236-f3ec8528849c K:\PROYECTOS\RED_la Puebla de Cazalla\Diseños\Definitivos\Datos_cambios paneles_La Puebla\Bocetos_paneles_mod_oct2018.pdf xmp.did:ae790212-9a9a-1f42-83dd-cf4dfa6bddbc uuid:0e10cdef-b208-440a-b236-f3ec8528849c Print Adobe PDF library 15.00 False PDF/X-4 PDF/X-4 OpenType - TT Arial 0 Monotype Typography 5.06 0 1252007918 1252007918 ArialMT OpenType - TT Khand 0 -- 1.100 0 3102800856 3102800856 Khand-Regular OpenType - TT Stymie Lt BT 0 Bitstream 1.54 0 1135031812 1135031812 StymieBT-Light OpenType - TT Stymie Lt BT 0 Bitstream 1.54 0 86774668 86774668 StymieBT-Bold OpenType - PS Myriad Pro 0 Adobe Systems 2.007 0 3357189407 3357189407 MyriadPro-Regular }ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw $}ICC_PROFILE{od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B}ICC_PROFILE3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQ}ICC_PROFILEDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKl}ICC_PROFILELnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 }ICC_PROFILE E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ }ICC_PROFILE K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:}ICC_PROFILE 7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_ki}ICC_PROFILE kvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht}ICC_PROFILE ! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{       # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: }ICC_PROFILEuGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhw}ICC_PROFILEgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=}ICC_PROFILEN=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dh}ICC_PROFILEjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<}ICC_PROFILE|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpaRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~}ICC_PROFILE !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$ݿkPfԝ G(y?ʗu.rg ٙ5,BoӜd%&6y'rOV$/ `^])E𹘾G^Ip:ɗaU5寵/פ3Z4>y} z)e;^N)/}z,.y[myQro5}nk3j*oyK)'ʗt%Q:W`+y{S=)3ٞD_gOҋ3oBtwQ}]K(z8Mn([r#*.kokK_j4&JԒқ_3?Gp[*')d OMlq|?*SGӮI'>N''fl?fs]ʏ"\9IϿӆAGe0?w} Ofs]ʏ"\9IϿӆAGe0?w} Ofs]ʏ"\9IϿӆAGe0?w} Ofs]ʏ"\9IϿӆAGe0?w} Ofs]b{6ͲTZ{y<(h|`Oq(h(["'п^)?Ro{/~k_ u'Yz31(Py_[r".";Y^=TO[-C(9(r /G+UkrFx)椔ܚ̳"w &ʆNd9" iObzrtȿi?VOl/g?kt*2/ZO?7 y=G'|K]dkyS"֕{סd5$?YH~UPڟa!_|?~OYBNy+/s^l7蜯lW^/peG_#EehQߐr4W^/pw!xfyuek+<.ug%}֔w 7Pv5գ{!]cS:d褯l(ylD_`+9G{!]"L9Cοe%'חWr?GC|ȈGY__X$r.v 9m/Z&e'b^gD/?ie_'Q_5 D_|י_?X!_ˣQ_4)9p?9?l凜>!_ˣPerOV_河}'Og _.;9J~ 8/%E%kgC?fAJ_|?כg2?^G .?ӦKK D_/g{S'%'W!{^)?|̾a[w2?_2]dS:d褯dP}IY3/~zd?KOO4(ylD_??Q'^a2T]6^lC g(a)Wm6O ^e T{/}ɺ&Ki|*NŴuu?2-鰖g /'v_'?C_YÓ|$yJޚ<[~me'&ka!-UQ6UM+deY_׮Retu><2yB?]~*|/ZWf9_ׇ?7_bO~EJGNG~`_?_ҍo'gb]$k%S~}]y.EU=ܺ}r?f?0FmUӔr:]4|C]-(kD].wo)??;Q'{!]>o?)hQsIGg?0w}LO.LT\v_JBQ?r&tJO57*n_q_g) OuWWYjyMGUrFG|ϼW|G(_g_'u9f;^;_sv(_a!Sg[Q%^UO>Pf5܋oj#b- Mt׶>Fl_ZYiԿ]?#ZV3+Q[6$ _RPU:]I[kӦB(JԞߩuBGBGoq ^wqk~gGi. }?E!#|?םg?Gu 6̟t/O[3׈K%4FvY Ǩ}n¤<@])xP^(@_x'ﵕ QH:WO/~{Ouy\d{'?ҧe0`U7<'П]lnJZ\nO?km _Z1y&>:_փQn抿_MÒs*c/e9D5/SAoKؿ̻66xG3$GD>[*!*o]0EG6^OW@ə yU-_/=\ҽ9@%ߟF~d] *vlgt1䈽/xoie\da: &{=D{91Iz3ԵMsH|`Jq["r^SZI~Z%ۯ_o-5?$L*dkyB5?.j +2O|M{!EUNK6ߨ>{.Br1>xyx+ӞIW?}&u'YGz>w֛u>|LeT.yQ 6BWCW+[~{yNK$jeMH_^bs*9a'Bu5|z_[#).H_j4oݘM{ d%ª۫9<7M~l{_J?(9??ӦGJs~ׇ/?Gʗt+ܣfg??ӦGJ??fKB?QOW33sGȟ#E%hl |O?!~](9OO4O~O'ٟR.{U'tI_?'x}?'|l{_YO^)T_5_S1ȍ:d+YH[dp \;YZ)IzO>l+ܗf_6dv[P.{O~{]p?ɿT9_˭Y|yRu73U:KTX$rn~@au"]/ZW̗M=>{My;&Uۤ?[K7"ub]= 7US+h"⧚~ޱ5Yx_yVSt?Xp>kC%O N [xd$׷96oE!O}t>g_~m"MɷRQE>ך )F&OK5~ 7]'̧;K4A߿nM'h_P5rw|щ 9EI_W^OC'wy7&%U}/߯sW=ʓ<&~_ ,9"wҿx=?fO_kJʇSE ,Mw._]j܆;di+5̣n;O;'v]~1̜x Lpq|u?'fJޚU} Iо6>>3|dwqy :_2᷏[%ɼfyk+&/ӭwwo;_6Z&u. o!y}(mxm+&~x}§BMCZu7 g[ -*rW"!*k*lr7zyk2^ԏNHTvA.MwO~_P5U.P$|Gg?O=z.M3ȗoKY^?1~d/G^ip9?&eo뺿WZ*.rX>~?|Mɺxg҉i)v'¿2n*~N$K;Zk\h ew3~z%(˚/g)k|>`/pʋnNZsexHw??*Ffkȟ#E%kd_~l{_G?*FfhS:d褯>>6gT/˯CgN{ne5ʇ!izOɥϙ'' {!IQeNv쫯C:fü_WY&;KӞEc? &僓Orsȿy_?w|̓N? &S9|̵ܚ|[{FRlM~{%rfHݯ3o>_'ܧ9_ʏ"\9;]?/%fKB?OOO1/sGȿ$EehlsO_;Gʗu/Aē=|Mژ>bK/Ѭ/r"2(E{) 4US_Zs~d}GhM;&&oĤ:.*}~RL+]7ٞ?|ȅ9F;KKM'̻EEw^Pw_uv15yIQG>E|vO-y^Zml%Uk[zjĿ2UWn;AU_;&<"REM 9IljrMU"o $8#Mҍ]x܅$I_{rEM=u=5Ey/>J&;_KӞEҟc^_Gɿ'FeT9_輯}fI'h^_^×4o|7.e);CKfy津ܚwUDW}}Ir_kSL׿7ӞGoƻ]?+$u%CG)F&Sy 9謿w~VI&_P5סLܳm[qu9;Ew\"/ [Y_^3ߊ>m䬑=;f"o嬯g6ۻO?Y'seHy<=~xWy?>?Ŀ`Ty:謯xlsO_;X6gT/ˣ]4*;ߒyyy/$Onס3X97?̯dT9_輯~?ߏy'_3+hX97?̯ʗ <9{Ͽ?3+k#|ɥB̿ ױA-? )|&7ȷۻ~-ᗒ.I6ZNrw|щsY~_dn~2WT; t+\2bg7ӞG~_dn]iKPk>ʇu-_Z3yCA5Gt=ӷ}hMww WO%䩿~{NMyzZN`>O+oM޺)9 )f*m/k'~Om홓}_-WC_/ң|he*?ؙ/J)܇ҫue}_M)o>o ~j2Zw<8;9.|Mď #wMʹKJ\:W}=#_w#ם\OKy' ^Me'Su}ʹh _O\*)}|o^hS%z?i= w4]<-OwٗGv<|&Ӿb)ԗi~#/]A7@|"z-:bBNZ92=//_Ҹy=DT~ۉ'/wuh)y3 xOJ亩DO<>ޜNJ@J/j~+kH~b 'w|Ro/!_5O-}}iz1_DVÐDUaTo`QS˜!YyޫѢt([uר#^ni ೬iS쭗Y }?Rw]:u\$K@Ej\TSF^>~$m_r~M6Qtb䪣W. j Uo?=`yC?+sCa[|D7MQP=<Ϥ㓻Ȟ`bݿWa%q]o1,T&>*j^["Ij6͙Dί%w")&*yaeUU⪪hH*ʃtw˓T1T;_x_-~ـ.>mO%-L{Fr>q^F(k+) ҫh-cr0U=jZs\"nlw+4Pg-hhnωVA7TU^D7yY죞\[I`hbn-dB*V#h"?_DޕvG"^MI#n!A"R{D_ۧ6}Jq>XN' .hZVˤUoGMO/Y][!.芊(϶[ᆬ?5Yo,)#f!uZt#~ i>FgiR&x:;*K?0lT9Jr[^S^МK?!lZvxtnyo#@aX~D#L#VwY${Zr0QyvQwTfqs؟雗rG\tT"](*F:~nq"r=NQLua9KWOö+"w] !?G1AV:7阛~cms-m~2?[?'=G.W ^~T*Swuw>ג|W.vv׏ <ۗu0SǸO2?_gZnr *Fq*ntT'|׿LSȯdlo=/f";"o~$Uo~Cɕ6UM9: .˔IvOm+ן|2;mWrEԟL=u]bNO)T-&9+eY=/`~TIO7oԿk/S$5[y7sC]iݵ4c/nSy 9謿k~~ozfz~gG_#Eeh}?E!#ޯ99s:?BNy+/sGi. ߞI?/sY?_sOwHGNoA&h\~Ώ7ӞGBG?_sr3GuK2ȗR?Mx<5M/z>Oߗz|O69o/}GuJӎCX__yKWo/g!D_5M7茏o_y_}z~gG~42?}oKVrNO?__yGi/Gt)Yq9?~M##Wo/פЄ eX!q ?^F}(_"6rD.!"nĖԆkIwoF^b{O6.Uߗ쮼(q/'Z_m/'^os3Q.rt!{ ~zw*Y/Oq<\|N s횜l9?COi?L 34.&! "**z~*GCοe%'l~ۧݯ9/?~~gGJO?_{Gk_+Gt(ylD_7MW茟nvxz~gGJO?_{Gk_+Gt(ylD_7MW茟nvxz~gGJO?_{Gk_+Gt(ylD_7MW茟nvxz~gGJO?_{Gk_+Gt(ylD_7MW茟nvxz~gGJO?_{Gk_+Gt(ylD_7MW茟nvxz~gGJO?_{Gk_+Gt(ylD_7MW茟nvxz~gGJO?_{Gk_+Gt(ylD_7MW茟nvxz~gGJO?_{Gk_+Gt(ylD_7MW茟nvxz~gGJO?_{Gk_+Gt(ylD_7MW茟nvxz~gGJO?_{Gk_+Gt(ylD_7MW茟nvxz~gGJO?_{Gk_+Gt(ylD_7MW茟nvxz~gGJO?_{Gk_+Gt(ylD_7MW茟nvxz~gGJO?_{Gk_+Gt(ylD_7MW茟nvxz~gGJO?_{Gk_+Gt(ylD_7MW茟nvxz~gGJO?_{Gk_+Gt(ylD_7MW茟nvxz~gGJO?_{Gk_+Gt(ylD_7MW茟nvxz~gGJO?_{Gk_+Gt(ylD_7MW茟nvxz~gGJO?_{Gk_+Gt(ylD_7MW茟nvxz~gGJO?_{Gk_+Gt(ylD_7MW茟nvxz~gGJO?_{Gk_+Gt(ylD_7MW茟nvxz~gGJO?_{Gk_+Gt(ylD_7MW茟nvxz~gGJO?_{Gk_+Gt(ylD_7MW茟nvxz~gGJO?_{Gk_+Gt(ylD_7MW茟nvxz~gGJO?_{Gk_+Gt(ylD_7MW茟nvxz~gGJO?_{Gk_+Gt(ylD_7MW茟nvxz~gGJO?_{Gk_+Gt(ylD_7MW茟nvxz~gGJO?_{Gk_+Gt(ylD_7MW茟nvxz~gGJO?_{Gk_+Gt(ylD_7MW茟nvxz~g^Ð,T>/|^mJ'_ޏvG1s^0_Sq,Qvh7EQ72?FG(kD$i= JׯY|GFG7Mw脏ۓOk.e.5MW茏.o ?'r:\Z=e]k?\5?4nOu?tz?<5_2?4(kD$hܞ_s%h+t(yjDdhQs}H= J/WP_}9r{\-ӥ_9E]!#sGS.ZK+G?_ˣCU##sGBGp\N?VY|GFG7Mw脏ۓOk.e.5MW茏.o ?'r:\Z=e]y>CͺWleGҟMzDȑ?ZwތW&;!M `iC".ʒE[xֿJOFOlnvxs:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:?<6_RFO?O_r<^Z=W?~_Cοe%'jDd_t\g/s:Y/z~~7vSo<φ+7Ͻ>%ߍfm#?./fʏ~ZΏ?᭮nMs\Q2MSFH[d[MŮ}S_qO+|;+ɛlm\:aI4GO VLVd)*+$( [k6tΰ;uz *͂)k梾OIzDE_nlQO>'@]x-TK4{ tq:? W"''w*ȿFw= K/'ҟR}EZ/H 䉾}֞ݿcZ&j^:īu)H~͒=am]f!9N "*B_yW??Əw}#t*}ktkoW[:ȋ.IEwO?kY:<<|5]-MlF%Wu'$D_|vk3m_M){JzѣFx?/f>BбߣA-miF4k~?.ѧ%~_Z-bѣFf`zS_O[ BMUѬQ:iky/榶et7/˭E>]e+o_GW쮍xqE~uQMo5_b+7҈{yпNa־ѣFmgt/T!Og[1GOѭx~pyou=/[O5_[0)MOi}:Tu '_Z/ &ɲ["}:qWw W_%/ѷְXPvo_tk޲k֍4hf>B_WSYk hֶF5Я1f>BWZ~WZ{֒}?_]h=^5DZh؋k.tпWM4h_&byU6~ɪx}:./Қ~_ni?&I5OɬZ:::4PJOu/czt度x"yI7\ny/榜Z_Meѣa?.܅)V\%DE*;})ӭ/ Py/榔kSJ5e҈~oғ>t?G[3Y_a1_O! {^ ~K^t֮4kr ӤKj>@O[pV#Mv|̅;٭z/xd k3m_MlHC6D_}UNTDċTU=EBuMMIR5#k_ɤiGGui&з^q6SuR DUgp^ ?m~EhKOяo(ǂX>ԡmJUTI/IV2 DUwtGݓ٦H{'7])FU$BQ[l4^uE]OvkeSoOlU괴ѡ*o?ӥAEE]#9/]oh%m} [.N R}Av>BB!! {Yt4hѣF4hѣF4hܓ]dl Uw5ezWS^v]SOOua?.6??>:~[a?.O~-iסB5BMD|=swED~({k 7LQET6=N8m&;%T=[auzWmUQU[uyzl7ooN~%2&ۚ/٬rԚlK3D_j}Z5w|<|BnNOI:FH>O$U&/OZjKxZst$nO4} ۫va{zwDM?oVOW .QU<)Ŭ?~]klJ{kOɣcSߋGħ߰?Fi?&~umMoBw<:<ϯ݇Mo5W}w[׽4hք6 i:ɿgn{?5mֲּ}_WkAԮ/U^157%(|kRsV>Q_cmtmZX2Dw^#^Ÿ}_1oAwo4)Y^!{~'OD=_=;uoﷆLv_WMjIVm%ak)DX \;l *~C=Kkܜ6ҥ-V:SuyQcE sCtZT/~):Ti6!!8~sI|>*S dĿ@NE 5?Jk"]dqQbc7℟&<-GIoR\Nv6xר&y):mF]x&"Ľk2\:Ccd"&SE )nx\&]"%UouѱiD|<69bKB̫!#c, 3bDBN-7~x3;m5+gdO쏳R[ z6 HUU\؍]7QwmvÀ6 B $;<ʫ*G_ 6"WlH瑱#5:Um]Q<vO]n?2"P8?Dis`zEJ_M+<}e'm<@BQDVF-$IDzkhp! (}M )+5}JZ8*e_[$Ȉ*(  xxiO)!"/+Tw]*5*l8^&8n .~޿=ea4"27DmoDf#of*I*-/؈~/ $]#TeW $b&5ۨ|Wuf9' #R3<6}~I<[Z ʑ^IJvI*z)`Dke_U6n[F6(>ڰN!@OQ͵yIEz6W縧ӦW|ENkyMQ<O^!7Tvқ6<5i6IM/UOh&X'R{!*xo}zпWM/Gl {nO L`ëuWWhyׅҋk/SeJ >xo}Z4EEvIW}}_V抟O-zEeB .}QQ_JƇm緷_^uFhѣF4hѣF4ka3N / m=84hѣF4hѣF4k#~k3JrhMkSFb/Ca[&9 gFN4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF5ӨU>u[PdH^벮۶BkFz+iw8S4hW_w4z+h/Tn=e4}*F>?n[FE~Myʟ7ѣG_즏eOѣ_SGq th)8S4hW_w4z+h/Tn /52sFqqdq7%!DM5HZ4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4*""'y&-xqd me]TU]~o?O/O{j} 7Kwo_~~]cM?>%7Oˣ~_ɣaGPtituK4|;߼ ?hoގ?m?.i&{yB_G?O/~0](_ٿ[z: :>} 7KwoGA}V_t g|Vn=w)~#?;uz>OW.Iiw)U.KQDܬd*du;{wNd>Ƿ_p<ڤN['̮w5f*UWMi+]oզAIb6HH'OB2h7OkD؝U枕5QW UzkJ9lo M}^ HS5Uo_VGRs?O>.OZ2G_њ~?ēJFE}S7 "m&[~7^ g7>QD=ɨmU< ~Jk~҇ƻ`ҏ·_ˣ~>5޷~o?tz/7]pEUweey=2%A_?"O=ihMxCMMwu Jx/{m'9$co4|[oM"(H*&$^.!zDE>$y_½> yZ>ʞͶ״:J𠗂!u{ "^]xPKtD.wwDT{~.芞iJR/{dEz^[ֳ|RؿY:J"^}zٯxEA })_a~ץO\W_.}s~=s_.\:ˣR-<|euUWo%S]a{~.芞l'~2TҏǵRD[_![Qs'?3]k5㿒ֳiI<=~h9E#T$:U|>]6{_@eIQIϲS{2]m>]mt'_Ysc?| Ytt'_G@]w15& B%.CM}>;ǙNŵU^BBe}>;9 Uz}M}> *m総_kN!}^۱|ů57ZgStMSJ'uҡ:nYH ^]n$&y͗nO/w[ I 9ȡ[xwu:u!*l>O eX(`N)*x^:`Y* v&-&y i+B*)5W"%??b6Ty6_%okӨ|UWoƾ;k(*пBz"t*ʨ_:KnN/o/9ֿW] tuG9:ˬ%EAI_ktQ׭iSD[UDB/X_5O/Oп^UZd"'uܗSouETEO$z›Se4']<=[ВnI巷kx:ou6ob/Yvv=JpZ"ܷV|vTB /:B8"{@6]c N#HԂiʾl4؊*{>Z🚖OfI*Ofb"J/椩&5-o[2)'䫲TOtSQ|&1RDR]7We/Kyǧ=[ߤRMV6]RPmR9 T"R[/ ا-n"쿺V$Ƌ>(&wsG, Tq7Ǭ dmᷰ8![ED#DOfΧӯiշkBThmUW=qSeK]JuZ tFIVQwClQ=4b&-^ɷ1SefA~oO^~?N#{͸iSO!%Z~rxx8DZ}MȨ *IyW_}%)5^A1Zzh_O&g#"/J%OWt3i|Cn&|#;.c׃hGW5OȚ҅N)]j-)o)u6.mﯳM0 MQT<$b_f`ϐm>`EhBE`m}Jl}>R::|U@6<&͏LQ:<ѴOfcDM]]u]?u>4dzF߁2g}]$^m }:N{q׺n6EG';}ZMyQEEUBE|"􇓧?xwon#\q * f"*;< KI-ɰY:1 ch:ˊBdOjʾI(g(.*o{Z%q%AOct>˛ywNA*oZ{#'ѧR- *ҩDֲh<|TOZO^K;&]o _ȁ{?ו`KT~$u%2hslZ݃MM@7c_[pfdiMPoT6ehwWmJEOOObK!Q ăڛ{M+uYKSkT-U؃.|aT$qQSub^bmo%OSkM=DDHڣ*=*JҀ קո*.C׎ {"(}/*_ˬ,Ȑd`뺦&(A`=G_x~&}{}ZQMO/[.$&;M|ė^QT.M8ڪ י*,& &ƻȞ> ڈZqBq&6Q5_hW}_ "ʋ'ѯQTC7"Owzu2zkT|<ۿ^#UG{*{ (ۯMk75%dzIWT_3 B*J&*&?KR$*IfЊnK緳i69ͣC| }Ңtɡ[R<5VE]=ӥz Bj> ~+KeTB_2+WIhb퇟v;nH)_j/Ja$E[geMo5巀aeTk5W/ˬi2Bn E~,]f??$co5:|>ĺ^ uن{=J)hfᷟк=s_?a.ko c_.\=sz:ˬFJ忆J}k>{пJ}zހK5i݄Eq eM={]__ҟ^_UE?_V=RUwEuyu}dUKh>*'փ!.~Lz.v$A^TW?&dTw/g>2 Qa1"n{?{{u~>ƿAmwD4_jmTP7M&<mfͽW}}S[)bm柳}m 6Ȝy?M~;']f#Y]IJiƾeYIeiWMT6ٯn@f`."(!nʤlkץtPa.Vȏ~wOof0]+f׵62k07WDJq6 [CZy2gCM~;']{qPA=PED]ӯNLuŲDQ }=So{_A@f 訣~z#'d]<>jz'W۬hJ>)ǯ O_1MYڊۛǷ(􎶚dMII6DT￱~lD4y5,k8%^}^&CiPGmI}FIڶ*m=ձ[`7 d Umzm=b{x/ԟF}KSkC[OG"|S@~]:=KShVG95[HJ*һ=o%UT>O_d|U=5Mb:)Fdm~uq;=} 񒿱4}3ohO&1}'=DV =ESM%kÍJm*{Q~mD嫅@P"ӳ}x0MWпVR#i?lM MGoTץx!ƀ86緳"klICc[ 5ko-d_|ZG-UwMڊ{[>{Ԋ x{z6]~UDE6ESڄlZ࿇-aAv_y|˧ةD~Ϗxof TA_{dѣ$kgF4WNն[/m'ӭdmkBsU|:}~mtt#{o.HJ>^f_.D<˭ff({M~~GZ_u?a."/_RoGZ_u+կ%/PWT.H{'yVV3'GD@>j~Ɯ EuEaL\}DUMAO=k!"{erFE#Sŷ)>j@Ef/[eW(ԅ]Mwױ#Oblo*k !b'zyT 'f&C_i vmo-U\)%5!DJO/6( |p_ԳQMRDtH _ uVZ*+>燂/R}?K xmҕ^Q"߼[ފOtz^6:w~$r7bT:V&ޘD]VJ ;>\m"t7|Q=uRQ8U}DE>bkžiilJrcׂ HݶԔ1c0p' c5*/}Lzݽ|2?ғe`m txEA|<U}WZy 2o@Il<6khooq- 0Њꂀ)΢oi}dwTWU:Hϧ}m~;Nʂd`OsE?uY$*{+=+Qx*۾"kt_ޟ[n2^:$+^f}xT >I4D_봛aK"VkXu|B_&m\݁0ʄ"+̕] bxV-Lz`JC*RWTr'Ѭs=֨a-+᷋"kۙͳQwjOЩ햿NCzbm>5d/bU/.1MZnv.$D[}KtFѣG9>75YZ>onR}[m_^)o<6ƴk/I~~Me_.$mh_GZ_t}$mhfKoHzvA,Tk:MܛzCi^kk@],hП_~M t}hП_~M t}hП_~M t}hП_~M t}hפ-uOmnZpЦ};*/m~ƶ4kf/T:cltkYtѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѯ'W~k4oKZ6_'5zXthѣF4hѣF4hѣF4jm̯,a?AGz(F/yl{U<q,$j_絏x4{6s?M'?s2tz$o㶙CmvH/O'u=BN[ZrM|Ӗ)~$^;;oӤxxtJyBތb[)xut0]O5Uﴯ VIx}PCe_fȊ"gDMQ'˾Kҽ=;!t /EM6Sۿլm5GJ(N|m6gF4hѣF4hѣFb/C}u5Яjk[Z]4hfQ-@U/ho䄈/y/G PSU>lQE]_-8SF÷:'ҟSF?o] JOˬN- >_4B(((_4aeu^AE_4U5FtT]oҿOխ}acѣFdhzQ~n?G׶UD]M7^:o-x6ɷ};u( zCxAּSȊ~s~t* ;*ɲx{5a>ֿ"V⧖ߜ?ZC}8&azvݵ<Vc_ mMoGJzѣFbtWoyob'OQUv<*-ax1EDrDثx5__NuEMTW׾OOWG_tlB=?_tlB#@J[{S^zW}Z}Q|Q|&ֽ&4k a?O]x?/D~_]b֮hѣF.o徽 u.ZoOˣm_ ק~~/tz_~FDW--.}_goyk"~Mg׭{M4h7GQ?b]y!M}x6D-_^ 7O-~`mӷ@miDTDt싾zƃ'ȗG{vA.孑$eooeyk;(?B}^ΡAw}ۦgmzǬzFO^1u'.bWXZ4hѬnP'ӿ7GQ?b]ax=ADEbEةx4<7.guOjoկƙҾckصҩ}{ КSmF|<m_[!ӺJ-oDlwM]Uym >"(Ȼm };t+"x{K^NUQ6O{U}y'tN%Uk l~Dn_mD$ ]ETU]}~ fZsS8 *x0kV?a8k(HiT(.[eЯzRhѣHtiS*<JqUQ7`u^Fi&[ >K]}#uSt^-54%:UUE_q7) Ucg `-uؚ9wO!wuUO-$Y7p7!&{<|t1lN~oO-cpm妢XJH悾iRf#./ ҌJ`*A+^{Uv}ֳD'iϲ"EUR/*z)#3tR3T|]i 6TOjd%_xUUWm&|pnD'|UuO>gYDZlDNpWysoKJX'ۤ)qto}wſKĊD蒢)&iZjoG_?tuTw2_&O5tMkM&/`s/WO7o J/ X-U*5֗b]uu4_P>Y"O˭e?&Q?'$:X^/PPP$]S}~k}64/BBO/X^DEؑvE*oӯ :Sumj#Fu]k\TNW~OЈ'~]o"҉⨊*(t~ѭ!DUQ%~F즏U>I[M#j~>.߾P!$D]8S}b7K( ^;y~=dhzQ~~h{=!_ifä<Ri:WdBm}ǫL~I.E$_wOZ'_q:z!B5mhѣFbyPEv_y<T]O=XTE]O?7۷Xw6%_2؟NCDD]~5;Ix[j}:Uon+j*[m:QeN}) /.|P?Ŷ=~wl|<:w}OYu PQ6$_=>%ޚ|QW}7^.Do{ZGZ4hѬ/P"Ȼ%^zo䇭6zoE//_u.E//=.G [1[QqUIKTo]cuE;{iZN.9'Qɯ־ţFET;oeiQ zۥ|Sס]7װ]oDP7O4E7U}ZoQ_ |oZQvG~<}v7ܗZ,CȢZ?=&cWS]/ Q}Q] [x(t4.P/OwU-Ǥ*{}ZPD{m~~ˢ7Jk^'қ?_3J?qtߓq5|5uKӾVB}+_}oj}Kk޼'An鷇'v٬j֙W6} k0_s鯵z5]הMס">kֱG&PWaOqDwTE_-5,zi֩/Ҿ{^ U|ٲyk_4hѣF4hѣF5M*V?ɣFF4hѣF4hѣF"Io E_Flb2l^=+~hѬZ[g? x&|v~>5-wdrEt;4l'_۴QW_4""+>{h[[E]?a4z+a2aP:=~?tۈHwC؟kʶtzz6˯uTSUiSemv:- mOfmʾ<6=)o׿O>~kimAvZ%(SȒ"Ta U>to||Ion{x"'w[UOT^{&azkKS_/Ǥ1.OC6U_^* lvEWn42QN6y1~)yzvvv,t^E^a)vK2I/N*'mU=h[;*{Xldcd&&ߣӒGx~[x9ymN?~?.54k.iQ?ƿZr>Wq ~z3ZzOң>_wX<ZG/־I~9<~?qdo dhѣF4hѣF4h֜?\ѣZz\ѣFcntkc[ɣF5on鿙Jo4k&F4hѣF4hѣF4hѣ[1_װ_M-c[˧n4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣFy?SY RZѲ!=}å-5uF4hѣF4hѣF4hѣVkoee 2?|D1cC߿8a#Uݺ=ǵ9뜑VW:i9#їKjqi%ɍ}kTpOG>EQMGU|USډ:"o1tm:QU=ӦGoE]hF?وH)㲓hI8Nx']F^ m"ԩ}ک~=K$p!MOo5ѥsi@oWQ>8F[{A^&ZǣF4hѣF4hѭ/ P3m_Mfc+aֶF5RNET_o[]F"][QD_2}Ֆؚn"/x{5VU<7O$_j/k?G?.~4~?IyҿGGG?.}'_J~,[=.x'WKWR]nU\UU~ykF5z$qW0󪿶F#.ƪ_eeIwkiֶMڿNtm:!ҟ^8*ny'~&h.[x շZ/2l^֩蟇X@PI~X@PI~Z"&鷚5SbT&.k&4kF]ѭTdv?KBDO^J6~?p9)xJ߫ZэIS}h-/WX[-u.Eoe]3ھ*ylOiwO@4ux?ORVS<'J&ɺ/ҿ^TD5+mm}_+δk~_ˣOWGW쮎kÍ/k/ӯ7҈{yпN"ɿ'{uXuXhѣX_ ~~?.$׃]juF5z$qW0󪿶F#.ƪ_eeIwiCOW[~}_O.z=etz)~O.?m.8J"yB:}(線 *lɊ"x'Xu^5F5G Q|v_5Oj'+BJNѯ`$K"Ѻ}K@h0AOڿNLSӬ."':p}:k\=KZuHU:WdE-mL|wM:S'ҟFRxoJ}۪n > )*&_Mm65F5'.b a?O]x?/֮kWXhѣ^WנDU5MvM:5h_jmU o-~;`+SdSm]oJ{u}j[* *'ѷѭjۢ7Pu}""*٤̈}8 xo,_nˤDuPR?h;!"Oˤ{?8_f"h#_b&tx~-g*_㬴` Q}=gn_wfX*k)]hJ=&T~;*A&bA.Ӿe#T<ILPeDj ;i0vTۤSezJF2ۯwZ*n+l wod#T܏W`ZAv0*%17EпV ]reGoMSU_2kP#O"n=> Jf*Z//I<W_n#}+֛lkk!_?tuSw2_&j9?L_5+3DmezG^?L|Go ڋ˲hmU v?O`.??OɣcSߋGħ߰?Fi?&# +_[QG\!_DObz܄8".ͪS=ЯR^)~UeEO-`t;ᄊUeEO-Cyi1T5qT|:OtUܺvmꪢGZ v=i"xUDEDdZSiWQ}GYI_& >s[S[R_5/5SYEl"<}+l?RxͿl~4, _Bunzi#_[:~[_G_&o>O)yCf D5 R6u*+j?}݃#U Sѯ`]+շ}:P+˭U|QKEïd*n~5?Jrb'}SIX*)/ߏzd[O_KD~"'y�N I QU'Si_Yk.ʟMʞOɥE>]*K~}_ͣOWGK___z)~ִ[hku9T_Q=ZNs}- 濽?X_ ~?IZJ֮4k3m_M{?')?cZB/qj_HwO'/ׂ#Kq5e? u^uYhѣFb/C}u5Яok[Z4hѣZSEQ]D/ӭiH*u&֟_ZkFylxik~?.}QQUUUWmѭ_ uۊ +Ӻ"/m%MжO$}:ߎF⻢ m'&ِ>JyDETx{5n؏[UER^~j/Fڒ%_5־t4k8/ɿОì}u5E%a'"ֶzˣOEG@FIDDW kJ ?OKJEXk~?.ubѣF~yk"*+F78*"Љ/t>DT_gDdH{~]au7u{(&4,6CT\keSKY`4$A}hw_N &}|~˾M7KV zq? OUWҥH6]UW_o+_羝#Ote4m?IqtҳaO])7M{2?]lJ*+_gׯbUu^EO}^(Oe|6e}SuD_xiIävߧl '&%|PWoDO6T6O;hફ|=b(,֬}6<\DU_%կPWoZE6F4hѣF4hѣZgҥoCܚ4k_J4hѣF4hѣF4kn) ᅬO;HW@my4h*l UT~WOFxҋf翚~ ȉun+GITO.:꤄/^*@^=(ҸJe=:|vM_ ~,2D &<W4t/At/%OSf"벂x%ԺM`} WCy{٭*m:Y}NR}I#芾"y>lu}m:ZȚm{٧xjn;u۱^M7U<y_ }ib$f^_xObZ^_s܍6_Bxk~(2H/Jy[̀*mOjzXȂI_=+5D^wT"w5荑.žiGݾeg/ɯBH_D((֑Pmg}:ST_[d_=zjoDti<S[YuJ5ӗ'?7IfS[7=~KǬ??y~?&WO~[/I#1#~(k&uF4hѣF4hѣFO7S.4h/uKdo[M4hѬuM*V?ɣY5M4hѣF4hѣF4hѣFً"@jin[5];thѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣFPSuD n"AE"]<|ogx[׏U~~Mbѣoߴ_Gh&gK=V}E4zhѣoߴ_Gh&gK=V}E4zhѣoߴ_Gh&gK=V}E4zhѣoߴ_Gh&gK=V}E4zhѣoߴ_Gh&gK=V}E4zhѣoߴ_Gh&gK=V}E4zhѣoߴ_Gh&gKGd]~Gd]~/6J%lISo-zɣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣ_)"kU7_M~ .ȞkkFzkǪh&|C? _/ɣoߴ_G3n=V}E4|C? _/ɣoߴ_G3n=V}E4|C? _דua})k+/4.lbK B>zQW/ɭc'SMU~~Mdh[Ld [?O//ɣ/ɣ~_ɣoߴ_G1)[oߴ_GX?Gh&c'SGh&i&U~~MOnU~~McM>)O:c}[-V#o_Nsvؿf[ouD[^{/6=lo<2xY6H{ni ?V%\^<>~|lh~es E8:DH*忱~l6◚'ooؚxkhE }[ Hߏk`E }YP C" _m=լސ__դ]u?G7~z0A$u]v}Z/Oɯ= k>ţe?&khO&ehQRTz}UٷJ))/o dhRQSeT_f>[xy>g_ˬ_kc d_ˣ?a.s/|S@~]?a.RsWЕ6_a=W6_a}yiU}BBe>)U_/$5$1XIy\?t%F? `-?/B~ i!|:vRUSmׅy~Q]n*(_J)Ϡ?`N}v\`yTWMwCM%he~[^Qt4b_f>7N?EowOweM=(ޯ XIT!"TDUWtAE $j>+{53$MKmD)%_@":/J.b:pVIv *.b;iY]&JD* *n+≥ozqWz_ɽ3htr9&⮒y(ґQ?pIũ /Hߖ-b[=q6٥ h <|W؞ݽE*V2{2ӟ /x&?F-tפ;Z*)M#%o+k<:Stؽ5Kl $V#~):דUW-{4K>>JKul{i6=oLOSt7۫7Lз{PtYG<]/' 7DROsQNO}q\P}7TOnL.*jʊ%&)n5Qq=Dcq]l;#fIKeEBmOZC5TN`֨qU`X銪~{x!} :?[G?忷u*Q5]v}YLe/ӯJ.!˿_Y7]c/Oɯ= ?@>П_~M}%)4t'_GI~~M /{):W}^_wMٷ=U}|}xh_mk]_9>_ t|ko _h>G@]z"{*.%tzH(=N "&R{U~~~ oW׭~k&thѣ[IBUD|>[Q E*D?4EƿjkmQT%$O-W[o4 Qn*'fu/DmdT6KtMQo''ȸԤ[**x_bk 4;nXi%B=Smu*[>wXaUo)kM쥿OխAUO=gq%_$tDTUU_?k9"*PA4_4TO㶰8D;t*xЛmM`#Zo.M~/п^|Sd6T_-~|.bؚY#/Ɵ1N3Dؓ|uy6BOwm/ѬQ'DQ!|bM_藂{|}IjTR'q=@-Ui=O}`Ɏfn8 ( .Ī n{uX&)H^؁5T@mdDJ*巂#&!rBnh I"tD-u$wO!ګI nD*yWۭLUWo=?~[n($*;keF||~Mn<ةoJٯj"ЊJ>Y+m6Hjb*.OK}tWrdĠز$߁)!6.iľka.CFM2)6"tXQ/D7`VeG =dUNsT=?IN*2^ď~ɬcF.8.~eյOuGuIRETDoD*i'!f4%@uWm_Ly<#hh۪*ɦöIiAtEAs}wmM&tQot/僿ttJ"&3o'Y%DT>{[!$S]QPD|S=*WԾ .~կ?{\qY>_?*7d& yĩ t|>խrn-^6zO?ySUHܐ " ){H{H6]aqqI_SګrkMAm3wG8eֹVEEGr~}Z B$%tM6}zV&ET_obkʮ+' rs%n/ѯ .%㿵=XK翆 Uz}M}>li*Jx}kD5MN**m.Q{W5>OMz MQwW}z2#x hjKm,x ~׺dؚƲ]lASm_5=o7bސxZ%鉢{u鷆)PDIDQA _[Orjt{*#}/YZۣ ȝ(d_FOl'\y!%|Q]yȭ4м$jd] ҉x‹j^i,T%7s4#or2*h;ʋMB|F͂k75Ơ)8((wAu[TE[Mԏ<}ҔZx8F"7OkKv,%7Q:}4$Oh/[*jo'' {[_[ .}$Uب]"۰0=%"OHwĜ TP<6M#ĺW˧ؚBD3~ WWˣd֤VT6RDED//|i6|[ۛ(lWRnAw#h夸co=߂l^}~(ZaU_WoRik5j<@@JFn{tleN*B ]_Onճ\2)<  eջI|4`GIHAPQUWw5w x/>?'v+סp^DSE<=^."".wRmkHDOy<Oe_f y:IvD^utנI~~Mx35otz34z k/K8!J*jL и *$_چ 8ϼJڂJGcsBUU]-U"xk7r@EDD//?i.ٕ פUS}tRY9x!~jȑ"&G**쩶岯.uI7OTO>h 4nKӷlH[om6Иh$$҃x> ּG`M5sPTP yX}3S4}GU}A쨾[xZ/C~_ɭx?k?m?.i&x?haTqwO_gH/#+"t/Ӹk[4hּ}`A4/DBOoXeTEEOj/ӬGzBBU|Sڋ@OQ<>/~j .BD= F,1QQ_gkT e\_H=S_/KmM|o46TG䉭iE6D_5oˆ_[7j'Ju1qlAQS}OSo{^_5VzנI~~M&|_sG _GI~~MGB}5`GT=QKv]~'[~*l>ΟX$:DH lҨD= z]kvTeQD V3hVJCn#7/ySD_nNZ:u~l>4)nd**ᾳH-P)/jJ?䉬*H /<5DQU_m_'&GEEqO5UM!D+D*?k~n꩷xxݚD1ԑG~ܕ6٭S^~?Nɬ>}%)4O&'_GB}4zП_~M ֜3Bm + &(:ӚkqCSe/Q]jMp&$q *6քXԞdz9 u6c$N5uE<||u3C1SUEUDOUQ<<7p! aBmLEU[MJc")lj*ʉnS!e\/"^Os|l+h o㷘MHr`GmSSbR#Nү槒kXƂڣx)ߤ5UiGD5=Tӧgؚu }OjӬ_t^7O Gڛ{5O"cӱ^[A!M~pg"O6Fc 75$ xKv#>H>?g%dDE tCO"T'rBt"(n"eME@AET-$U%Mkˆ" lT:O&KSkS>П_~M _GB}4t'_GB}4zП_~M П_~M}%)4t'_GB}4t'_GI~~M П_~M~ce"kR[H(*k㷚 M)WHQ@USdq~y!AmwD4d ;)!o(I肯R'䢫$oJd/֫Γe|Q([>Ǘk[?W(P*}~zϥHКxQHMЗQO" ҃u<|}WJQ6bdF[xWؚh^jKӷѢL&Q'dW̶{4?zHG[{4I- ԢH>Obq%_$k)^"&OENyTQ6'oKh_PCRN=Uϧ}Eokce?&:ɤ`5DR]T/^ɬ] _@>O&kkv#LXTU3q<m>1uSE^zan[~Ժ0>fyoۭҊ+dn۬KVBx{QWة/OȚh-">Gؚuľ"oZ+9B Ȣ{yׅh~R_QA[m:OSo/=-Rѳ+A> ߢ^*^V~])k^?GS~wˡ6X_====*>;o_FB#i9!vƓN0]x^km*TQS50"si@#6 )j} []Н] M( (yF<W&kɦd6j (./NUAmPeE_&*?uz*6-&tOIm~~V[aE/ З-5 '{ⅷWҔy𣦀H{қnJIB.IdUGu}̶"{5%dUEvA_y|obYe' +ʹ슺iJrA#$J*'NkkmEU%AߩQ|ֿB&j?Rӎl]QU^g}!l :ϣJѣFeho-Kk+@վym_^P k/I~~Me/Oɯ} ѣe?&@>:ɣGI~~Mi`?G_O~.S?޿V}%)5_K ѣe?&@>:ɣ^7o'ӯ`{{7 :5^F4kf8!ᅦOޯ~z˥Q<@!Fz^[{}_~{B}6ϠI~~Mz&|Y/Oɯ] _G5?d_GB}4zM~4zП_~M}%)4|_sG}%)4t'_GI~~MGI~~M _G5?d_GB}4zM~4zП_~MeeUE_ҟR}pdPMUKTTQW)zV%8G4#_R}Bz־F4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣFeMcw2_&tkOZzMѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF]dkAԮG?ks[RѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѬn_7/Rk O_F4hѣF4hѣFeO9G44kiF4hѣF4hѣF4hѣV7ek%2~C1ks$]s&\?|qs뼍VWzk/Im?vpuK?߉ROҘ ?pOi<>~?]i_5ן>t"y'OwKQSoba_ؿ[OH{{|wX=U.o6~+ktSSG_%}|WѺ}))*.[MeiβTw[S3z ډףt_%Mg}mkF4hѣ[_SY+5zJ uϛ?t߷7[Mu#[K]hˁ?]-xgZ4hѣF4hѣFa֛o[O_=i׿׃M6ٿXX_att;_tlBw/ t.[m巵>5[]װEEE:vm]zM4hѯ$J)ɿtnC=Jߋ_J>"*k7o!~ҞKAǏ}K|IRS"U<>҅tO1*I促[&8{)EM%OzRxlLZOxRDTEM{cd8~vd_{v]KT)΋)EqTc!xod9Tπ{dqu uxorBq wD ED֮b<MfQ/)dZ"6#"*U/׭\Z&V}EWFVWaPt6swuݶUNm~CAxUUT+<SYQ]~w׬~o_^8ꟻ*' 'ѬMy֓&K'ATTUB6O=ky'7&o>/1׆o_Zk&nF芻}g~OG]b~wׯd{䫬: }kӎoBy/פ\qN}W} ïEkEv]/դSڽIIn ة\tww.RmݎJ ~4MiXB~7tMhر|օBl'֒ߒF~= E}Q6,ߜ-#WGk&/gHq?<^[_O~Zl5樛nۧk /oӡUٺnߛ-4; ?vof#ݷJnåf[FvAoҋk}?Ҥ0 <oaKkh$DU&tDmQ7/TG6]7WUk_?{?nC?e'>G_EG9Z>?}_]o{Ĕ~}:_+[*}Ki BVn>`6^^0>ƿ?gw_faT EES}}m`=ޕTDߧ׶ӧ vl̖/FmDNP }oO_~O4oǭk>&n"[uOm"un+~aG/4gk֔y]('~*54iZ;*o~oE$v*+'҄sET|Y]ojBUU٠N_ ]M7_?Ǧ˰nԾ5+''ZP[x =ivۧc֬@ApWd]m=hײM<*H2J: *Ⱦ"[yocEm!sK~_eO9\!r+c_}|}wy'[B~>{} ]jzi?֯I~]`w/=_ˣOi?&L:? }Two4t7oݿUT_4tmω_/Ѻ}))>}_F_/Ѻ}))Oh׃q]N]K<=yTq ˫M" *.½KʞH^tvEؐ䊞_^5q%]a^a{|<s٭_I~?zZ~-~t.IOާ9ҟOumҩ⊞uZ@]<6;}~YU.UcM]|}fק|ٶ#BIv6Y^}]< >ڮIB*}o-z3BOgw}h6CNC6Ooq~Ze{mt{l拭xӇ_4hѤT8l~sIHn4IC"eּE/PH(n}_Vhz=yuTꟊY|6٥!Hߣ4UASvM,8߹=Kлn?WójnodwOb}^%EaVKʎxMLkӲtӞy*oGrQۧd}ҟ9/u4Y=?WG ~M_o?^I~+Oi?&O|7/G_4G>_ Oɣk`Ϧ;nh |(뿞[k ((&m__=)׍kkƍ4hѣF4hѣFoo4-kǫmm"/-*֊JH <. +Ngo6ؚ*/J('Pnmkl~j9R~{7.PU=O{Z! IԊiK'mDVȉ<nGKؚYߦon[yzZU|vbn?=**({QSm5I?ifK*COK,?YK'}3NC_?wHQO|Et4߫}o7_j)T*k&(INx*{v׃pCI:eTeO_KɲiLTQtu5TweѺ&+[O!UW"m橥 `;j&(*{oIf{Jq"^%_%_Ӟ`:J BӪ%Z;('QGm۷V4uwd*{ʞ>>B4Ҡ0xo-+|Q$2"ͣ_ab^|Q :_ ׹ʐє Hh}]& }w_y h&y~: }OﵦO},*O_ҿ)4OFmkJ]ޅ<5mk>֞^۫mgӢKz%-rx'Qu~~?;#^NWyie>=4_k4kQ?_C4k0}?J~%a?^[䟁?sZ'"ӆ-~hKF4kacn7_ѭlk&4hѭ9tMˣFF4hѣF4hѣ[??ka\FƗ5F4hѣF4hѣF4hѣ^55+4?-*O_ƵYuhѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF~/X I2??֞thѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF5 ?WY+鿩-攴hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4k5T#ѭ=i7F4hѣF4hѣF_AN ìmѣF4hѣF4hѣF4hբ_Zt̯+߯P_Z?\ɿ%?-:7?={_\gn#Օޚ) [_tݽ#\)E~4?_-6/OZiMo5uϳ]+EȞI51vh}'~ixyI]7M=~)ziu'S&_eu?z4u:_F쮎~5'_}8||[aDGz[_Ն x{٥nc^hѣF5e5Rϟ_נIqt߷7[SK[u߷7_?0a?֍ [c׍6uF4hѣF4hѯ`Ffs_ oMg(f}_ڟ^Mv?_ﵵ_ﵷ?SY_att;G@M/пcymm]a|vOf *"}OD/ׇQt_?.kWZãF߮O{oDc|?}}w:zhn#oǥD="CM[1[QWz՝W>LmKMMag ^'Vt!]~o%

ì1"tNo kņ璮A/׭XpEmW["Rm 2hc^ L:PBFڹ}ŌJޢo^_٧#RN@^OnN@ ⪈[֎:/Y+u}_VWϣrdۜQR-PwY {Dֻ֟ux* }RZ[|b*n;S~T%NEoI' .%-Kn}/UT|}_k}QIuxu)mu֪}5tU?Ǭ?JotycmK~ֻ*zFbqiv>_?ůIqu>~?]dc/KZRg.ZCoͿ?]ocF4hѣX_ ~~?.$׃]juF5Яjk3m_M{?ֲkYthѣ^Wt6^Wt6^mvЯJ.8~wׯ$Jվ{WJ쟝#5EUۿפםU]|T9uk󼴘xߝWZ[}|#/~׈~:GtT%Os˩|~6^~M{q͑}^;z"|wʈ䟜EOE{*}+ղߜH7ԕUQUvR}kX||7ZDjUWZ~/}HD}K5o8!V˾{?M8bPOץݷiR?7[Nw_&e=7پ$ ).!* .ۢxi{Oi* (TOЯG׆i* (2TSmi.0 |EW_M_ZJ;$Eb}aiQ>-Ϳ]PA]O÷O5~mJSu> ^O=md`VAjZx*&/67]Kȅ<{X$I B_J;x׭O'4 O?ׯM>?x ?4zk7bbUůԌ˿:||_X܈-  WmOfm(4_RUUou?&Mo2[&^ﷱ56y|wH֮*##d<<4b n/*'HwKrëD:|׷Q+, Ĵ>yV`.d ӫE8GOR'nؚoHVZMWDwCQ_5<9[ulщ(S~N5_`=*.^kXX}]SuyFAVSulUQwQEJkЋk~\dhU@Wm@_][h<^jϣ&Uw EMDAE<ٺ}:'*mկ:+u5_⨟J"ѣ[×迫 z!M8]SM(~~_xXhѣZҿODOF5]4hѣF4hѣFUDTO»kJn߳.:B1uKқz+Hꢒ$ wҺSaQUAM6Mng7/*t;x ka4ʊ&^^[:ך>o䈺֞>JmmO}þ^txoytm={|:4=%^oǦ̃HQEQzS{ۭXu:C6V?_-/5?ƿ-)F_?PO$ Tkhۥ(m緱&IATm~k#Ъo]}5DSu~=&H.抾 ԩ˾۪PׯT%mh+(+oxأZʋҞkȧߋ^Ev~ϖ>~;h6oZTDE_[ UA_Ox7f:Wm}J}_^0GKdğS)za'}_]}# tlؓ [a?._]'YpT4 n'9Ѱ.EP:J)x~aomQTUW<?'f})*tj;_=["mӷޝ$* ?k<6m-moփāA^ݷIxx. vAtIQ%w_>׈? STwݴT^Y*x}:%DMWt~])z)?a?Ҟ?J>_.'&E?''7y=?Ѳ}  n~uSI$=)hX:ǣF،./omDWKtE:،{̦u5)4)5ҿ_>)4tG ~M+ˣdXAMO$D.'"xIhnJ<<.HzǣF/OO5 q_<Pzo&ښО僚l ҿmS؟V')$fFx{j~X8(B*੬ h[lAkSּWze^xķu]yO4)\tvlKdOFeEEUwmniQRM[Tx&ۭm%OZ4hѭ)ȊO4OZEȋ斴˷ׇtM.kAz=DSzdx{t:SaӬdYElS dgM}}^ ~*zm;;~h;ykpQ]<4[[/{w*=Q:<zDiTQLYBuoԛum߱uzD][HCz}]q |-x/1?M:v?f}FCoq|T_B? _Џz]oד+u4ɔ:KZɏ9>c_vO~&|)pby/榳.iQ?ƿFe\??sFOCKq4ϗ_Kq5^u_:ΞI5l/]8kB~ΔhѣF??_#~ƲhѣFӗ'?7KOAܺ4kOK4hѣF4hѣF5SOvo ]dolisY4hѣF4hѣF4hѣF5<SZҿOҭG$ k^1uZq4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4k5T#ѭ=i7F4kIvO]~).⫯%AW<7yh׿I]{_{='?{ctzN~wyѣs?Gl.{='?{ctzN~wyѣs?Gl.{VSuM>VSuM>L(C'+{=ǣF4hѣF4hѣY+?hԖnksJZ4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF5RDUS^E TO]u5RlSu]O$_okzN~[s?Z??4zN~~0]_يn'֟_يn'֟^IvD]|ob^5XhѣF_AN ìmѣF4hѣF4hѣF4hբ_Zt̯+߯P_Z?\L'tOHPt/Km,E|.?ytnj$oe.ZeU?q_}+eR_tOdJQtM_NO?H64Qwo~/ըjɰқ~SW_joEB|S}6{mHxzax~>C(5=f =4WW_~]~9e5AqEDOEM|Zc0(//8&}HH'ʞObW_Xڔ շ':Qsj6d^k_ EUKǥ>t2Qg}w#zdzyᅭQOwڞێĨWʊVlA6]t@׾J*o*{5i<1~]ll^ 7/_i?&}&{et|lGFuI4zMGf+OCU2͘ OZpǬ@|T|t.F~]Qr2NSk0*6OGnRtCexk+pUm4EvU_(-S"%qr+b64;,¥?sk*W)odN?Dƭ^״lwMzTkBLXM2QZ+h*QM@|uW"4>'k֛Enmys@o&hnĈ+K.Ę,^['кNy,Zg'+ lZ;:?@K6&rwR9QQfdk3%CƬ6xCrWROOOu=ʾ[N?o^ XsmO?m-k?WȟF)WbW޽ _Gm-hJ(_n͉_z>_ˬpݏҟD58wJme|<ѬJ_m%W kC+~[~o'Z&|-15ZUf|4~~]m5;3o9ZUf˯Y&߫V^{xs9%D\Nv]a=>x>Vrʟ)>x8 6~u7ͿՏu+mgwX(M+c.6KV?[?R3;OO2~]fgϢm_IP63$^3+͒!UM<5k᧫_ľ*8럢]ȓ֌S}dn,IISW`_T]5]/Oc.IR^L?گ 51aǘ.y.=ؗfҷc>AzEIE<}"ۂKvײ?ļz MD5mdi{d "l#'.*x1اdW([xE|okrԢ~Bٯԯp|$CA6v?i|uXJ߳#k"reumG_Img5Ve4QD}7Ppr_/ &YM5kE:1qC.JZ<+$5W'n<1#W QD!Dw]~f#`~]6"%=zi슩:]2D:wEҚ2T_kA/ +ZN<ுm~-jcBf~n+'"&{Ok('ZE.A&`XHz~Ǫh&=G~?=n:~[sߴ?G:~[:ZߚSfuMz:W؞{󩭈Ϻ.լK"B})kksߴ?[}e~Moz~k?Y}?Gh&i?&U~Me~M:=W?}C4uI5IWW4)**).仯?s^u[M`^i}~KD~~J+ǬfuoᲯjk "^*쪩u'&:z'I**t&ʾ+xM`RUUk I n4؋tű)Ŭd[u&yxy"keXTw}).5%BT{S]eDj;B$кUDK[H>*H*//J-6)O'"J3߻lkf ;>i٬Nq6TۤSSekƛʞH BȮ"['~IdNl)?!QPtuO{5t8Fu(|=#68)(n*~jhdT KuO٥6 }Oٿmokx}iGuP]ɭNܼW}Fdw 8oZ[RQRD_laoyl?m.Qh^ٓҒ{ )'ץx[z|:Wښ h\l:HWPm<5AUPMmWtwZFAf>-QDV#*շkq1P]dvE٤%g_%ПO]nAxM":}iq=BBEV$O=+W3.V?Nu}9]"!SG3]qM援:"-SB.joT'LZCPTm|}x6ǼźyuCR}׬P~ĉҋ [M6 =>*j^*/UkFN_Se٧M Iқyx"*ʾ׶N_5_MW٭ ҉[mβTDSD= -QEaMQS|YM_??*;*ϧOfQ52UGoO'DH'Rݵ#OPD4&UU?&""{//"km-{no-(]ZI"_Wm'[Wzf<#VIQ:USwϣ[$;mmE2!C%4nDT$N]f1.Clu\@"USHv3qןTׇQN}ؓoI}5Q߫CT{Ȩ^(_-%KGZo̷]"T։Gf/X%R"WSc"O1M#ά- 㫸dh$6=&IҫlJ)?TPSvO%>>GjCAAOɬ.@}6_//1]d[k*2c䢟Gh&ɰЛu_A9l'+b&Ƌ^[~c|M::dObXݐl{{߽~6T'Q|xBX_X/ȸt.${PGmxK>;ᅭkwn>&ۦM(6/J(҅;/[`dHKʞ4 I_4E_O!u!tҜHQDiPu=ۆ/O>*lJ{iKoiCXoU~MҟZ>9߯&ccGh&,EICSǠ:S4(dM=Rl(С5zm$}:ㆢO~"M+sߴ?Ivi?&I~]>&;9OɭF"uUM:}S[s/{M}]ϑA+D F^*Db[>Sҁ{y'uf;oy}WHWt>>{W-R-M[u:uROǾOׯ'G15@fjٯЀQ~$_j.b 戋p_jJ> ޔ6&{k}/jMouvkXЪ{#mʺ~5tm]dNj{dnH;{>~&Ļ"~hm2T"6tOb'ӯ'ͯͬZ4hѭ/ Pr_[1_f>BҦFLyc]$%୸lHбu֘hI]UW5TؐIv6?5A((։_a}: yQ^xt(x"{ĞH(֜&Yu?J KI<Q=Ony}Zٗ =q~DT[U[P^_t[cFlA5E5D__%׷<<<B; ~?dyx:6 A}|]$_$ cu\ b5#缻 ]m]H "yxDtᾋE>ɧB&OMlƊ/_G*~ .[y#l}[ ֵFRU_YSeO7WںͶΤć RPQ6OؽuQeߧ~_U=_jk#;!n?n5FJ'0+D^/4hUMEq}U` ^W7u}ִ1meDd_QuO.CnoWy4ndS?id==CEA?đ},g ؟w!4j?ӏwTS$Tq8diֻ"mЉUC[mʻ/ȾJiJt芻 (﷼M&I J*"m**{5D_ז$i"5e>>u!U"z"_᪢)~}J=K~?i[8e'5['=5Oj{^$"HH*Q~etEWeؾufH*[o}WկfSQZɬ}e~M=W?}C4z~h/kN (H"x*o/NkzC'zV $M|QQ7v_"7 TSu1uo_I~?4ão_Gh&cOn]ZCw۾;yh{mwN_k_^mju;^=I_GY?_O'1]OɥjsiE6_E'Ӭ쓪.Nȉo)6[E;!+%/ {?G>dNxo"OObXM:w%_ܓ4*eU%oR׭շ_(*~w_{ؚ›**컪M׉c++Ш(^*+‹kb+5\H>ȁ)uo鏞ZSy_ڹtz{OWWW ~Z5$Hq\FKfǧu-V 翖@4")lmSҊ8i"@//nZf."lkE崘Ӥ"*_i:ąWuOƿ-`ytUUvOD]3mm]&udHrwD=[Hz/1UkSQUQS!mRm#Y KgnNnqUo=oO/M_Qt־[ya?I⥿OU.\-U~ȧ{=Ss~>u>. |QQ{5k5D ?$mz}b/mz:N.x"q=2O=]]^m%Ku1Xw:6ȓןV.wyAd?oהO$Ѹ{oOkQP/us_zױMRyET/iMQ ڿ vETHU tӤ2mGߤ~(vC6_-%ֹiu<֢y|Te>uLWk <⧉{~v\$AsdW,ljTz>٧~Y}?[3]zvD~jeԻ"yoiI$Ou<|WװU]lkc^hѣ^w]E)Bd;"~*z\ׯU~M~I4h\ɣOɣ[1On}[mkN[~ZmGz|Hvʦ5?G֟h&w?ѣ~_ˣsߴ?GFh\Qs:=W?}C4|o_F?m.U~Mw?ѯ`xo-ס{o~v[^tu⥿N}-]~ykߪh&|S?‡ɯ޲i?&U~MOnU~Me~MfhȺ}5:˫oMfwm<^UwnksYF5}ZC ["tV32=X:=>xnSC)m3^үݰ5㬾OɯO$דt6"7؉+1#%6%^/uUSb%O4M~)*u[:ѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣFcw2_&~/XdT:5=&ѣFdkAԮ5 ?WY RZ5)hѣF4hѣF4h7/Rk5G'/CZzn4hѣF4hѣFdkAԮ5 ?WY RZ5)hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣFcw2_&~/XdT:5=&ѣFy?S^'֜#5YѣF4hѣF4hѣF4hѫE2Ւ_W_赹{.>G\ y|Yǯ?YoY]71uEBpkƱkH:4hѣF?^1u鏰/& >s^_S[J7yO_ui&C}dםzѣF]Y/3][?Ljw;ocD4Uя:ڱZUѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4h_Zpduۧ֬W!H{'_OSWHKw9?_<U_¿ =Kտ}:8I:׎~u5QTok'_즳+koOˬ~~]=e4tittiuUWo4S׶U_-O^U=)mfMdѣF4hѣF4hׇ>i~xpzדETuU<>aWE~Mc/A}G_즏E~M~~]~~]fa_?SYYkb]+O5STT:[{>Sע_즶zɭE~Me/WП_~M: }*巚})k7izT_ku?ƿ|'_5_ck}ЏkޒBJA<O~J5/T}sfMO\'h|<gY\PpUUW}j/ӤUN=G_n!&_;j)"&*bz )no;JLuM*n^E*.oke.@OO~H؏X7/%hGU_I=AHM/T ]#(j{4ן<x~:~B(SI#]UQ7DB%of馔w}OvD޿6Q=KSh//O&b *mO_*i.OY5zѣFl_Yk k3m_MֶhѣF4hѣF4kRh!( ~XEQM|Ԛ @>/3O˯= _GA}GA}GB}5Q:zwSe_گw|<|Sy6S?5HI7EDwOiͼץhԊ˺{^QOOMmzkԛʋ㷳uSQ|ؓ_j'׾ETEQw>l#].ۂ#~n>T /EkmzTWؿHZ;[W.V}E5sߏGh&Y>]7??A ֋/5)Φ<>/btąWuSؿJkum∉~kƍ4kb9 .Щ_hي].8~eeQ wkᅡnk3x&˺'}YQ__}dl!oા߳k؞ͼK7/ zEyi5:O_hb[/V?'Ӭ&~{{wX}]%MU*&xT}?au_~f!>Ҫnm::.ۯЋ~f(ꪢ{5\EM}Bl \ܼ6_}mWaD_?-m檻x*о5ȿV~:duEOgv٭MTTo?kob~Mfƍ4k+G钗Q}[AT*xF0KtR#K*_`.so//ֿW]~] tu5GZ_u(!IۧkNjB((8&ۭI 8x ~rm7ITQo?.tJxETkYuUM4ֳNt{l*պy{?<>*"l*~8"*}O^xvI6_5MԼoɭ3mS$TU]7Mg٭qh5]mUQ||5H+{<<7_R'y~?&OK[~y5[Mu'.?$a?O]~bWZ-4heokB~P#)¾h'S "/ JU"*!/[}^ԴM"k抿'л{5\ڏ}OOkh^ fGUN'è tpD_%Oj ѥ2dUctaOGHꛄ J"*.˿y~">BD.)_zN7zקQ|wIv_YyLԦO}q5i?.ɯ?:Rg.S?~泧~cFԖ?$_k!~?.5}bѣFf`TOWډ:֔Jni%+A E"_:~_/]~]@>ţ_Cާ=KSh֔==?? ~㷞)}kwsĿ;ڟWկm3Z^_GֿI~~Mx/W_G_GA}[=_Gq^SoD [АWuTwװEMoy4" uc(W׽"HD+tOj: @.x'WZCa~kIdAT%-Wm|TuIDW Tښl˔-*R^Oo^6k#R:rDT_BEjy/ӷﴒrQ%D|:l ?qI6S:Qq}<|NIRD<7i)ÊOzHӷI }K  [kJS/a]QSnTt"AضM87Jp DUmOu$$_?u}?KQ^SeNMo|_>.1|#AФuu//w:*)B>EI o˧^cc]~_5U5JU/&4k ?qS?r:y'OFGwB_Ԧ/ֻ?sY4~>ҧKb??ז|)|~#~gC׍g--OF5t_F7ZѯG~hk1.zZgW~iM?ƿ'W~k ?M'?7['W=֞YKǬ)kHOO?SOv[/#~nksY5F4hѣF4hѣ[??kN_=1'4ѣF4hѣF4hѣF4hѣFcn I/uon4dѣFdo9tMˬn{?5Zz\=4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4h7/Rk5G'/CZzn4hFJ#_u?7%[Җ4hѣF4hѣFcw2_&~/XdT:5=&ѣF4hѣF4hFJ#_u?7%[Җ4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4h7/Rk5G'/CZzn4hד+u5>~?]i";ᡣXuM4hѣF4hѣF4hѣF_+K]Y/N~ы^['yW{şzAΜuF 5xZ_)iGPkF4kNoCOO^1u^ k5J ?qu~y]~~m5?[~iT>~?]gMy׭4hѫO?5չ?X񦩧s1tKKu_S-ť]4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣFE9?ᅨ{O[ -N*/m jT~1_/?ut~|~es__5+z$_*oïة5׈A&~W>~Ny{(IM(B~iS/GWѲ} /=?7AQSo=."''׃k7o-ѯ}~`=b׍4hѣF4hѣFdhzQ~n?Gװ}7ڟZ}:)Իyk?WMOMe? z_O h>?_3 'Z}SYZ"TMeiLzMڋlK$IMlu/W&B~h=$Ѳ} n{ym]ctE6ob*xhC>sC>sB}?_Q? )zIE~1UO  3tM]We·#OYƊ^ *꧳o2lEU-dWdOIu((. NqQ6W)7 <u]wUU}]xU}Gլ4o[xhwBDDE$O%׷- 'RJGJK⻪5aEo=kWZţF mwnJ{fZES}Kn%Dza&Ȼlou`.H[xn}_N^_KMn_ïB˺}J{?Nȭ~=o|7Uݓumѷ?ykdYDo7~lj[z]>~>~?F/R >_=l|/(ԭz]>+ߧm~tW"]M?O'~]?nE//=4ƟShO'~]cu6GMxqERRm^ StOo'"{_Xu^thѣ[1_f>B_WSF4hѣF4hѣFn)[o_%׃}gMxpzSb5Z?n+aM?ҟO:?d__zi?ҟO3TVSwf#RJ>{{6_^M:}Ds".lmesҊy!^^[k&/UU:{7ְj*'*пFM.S;ѯ^xl{ {'/K5tʟz~ѷ MTh~'?Oo1>z4/-~ku_5]xF5|~m5E_g5+һo-bpNo?g뤤쨞;_VȐQv^/:d^;׭/==_=k⥶ۮշNu^tNjֵo֣`/ԈŲZ/x u'* Vߓ;&/ѭWKK}e_/KtEUU/oѬAEs?~zX'R"/٪/Rx^_خ)(ʈ*oɥvS/SNЊ]^x/EDl҈("m}Wm_zXdO?˯zםyѣFUDTO»k.緇ӷ5⿃m~: ?.=zSaG_῿ 4{~޳0"騡 ډ׬̏J*^Bj'^6(7y~={lTPmSj}:NG⋲Obi2P/J*'TWI\]zWU eO}||v3t۷׭xϩ! n[i,(%/Ҿݕ5D-sNUپzOiVH'Ãu9yxiYֺuSeni]"mH|ѯIqu<XC'o%??_y<O^ ~'.O1u]j4kZP];uȊ֔SdQ77גM.履-x4<7.`6 =;"oҜ/|U6Onɥ` u舛*ᾲ/}:ܖTMu>lBR o-Q=imᬤv GqVK7m?)'xFl_0T]7Uv_u+*_Jq_SJQ/&OtkKO柅?wXѧ%?quc~_ j_Xhѣ[1Wg o/C$=I;oZIh=(nJǤWӋd_'П7_etzIM'П6O?a5|k]OX]D}/?bxy}Kly3X=$$ؓ [z=$I>)dğS ݽyk؂{vmN'i ֬MDW__Ruumm*}:J+ãoy?;ti^M>7%H z='~LlVJId?:~- h/үԛyk(6<vM|YO{~5B>һo "#h&xfåhjlNX@;n[çN>pT_TgqEMǡ>/B@GAt7ӂ WS==,DBUŔMhAaEo!O[6DIuAa>'t5_-4O]{ٷYO$o7o5СxO։Ѥ'o.jMۮ>ƒ>-I騩no?-?k?&M{Ұ}Uc/KM/OnTOAܺΞI5on)cKq5OM'j&ORX5u7? ~i!?_HߙYKASѭ#_]+bhѬ~ִ?4k_ K^'֙_Sgk_/OneO/kUgf|(y~?&_i ~z/kR:5SOvD߷7[MdѣF4hѣF4hOO?ӗ'?7OLCz?:5==4hѣF4hѣF4hѣF4hѣF?Kdo(kcY4hѣY/N_.S?rd֞5F4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF5RDUS^E TO]u5RlSu]O$_okzN~[s?Z??4zN~~0]^ aM]|Q<U|^ aM]|Q<U|^l4qumQ<U|Fzk7h&~!/th[/ɣRFQ%u_&Q%u_& ͒ny&F޲hѣFcw2_&~/XdT:5=&ѣF4hѣF4hFJ#_u?7%[Җ4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4h7/Rk5G'/CZzn4hד+u5>~?]i";ᡣXuM4hѣF4hѣF4hѣF_+K]Y/N~ы^['띹Q>GbBGժo}y?bkV>]yN7?V.zx?|@RU]iB%WKu_P"dPtQ|?4א%U_f4dѣFmiԈʞObQ_zM7~zMG6k#"l?^vm^^z&AWo/b/.nBt zUdM|wDE *} }ވj&[&ž=CDE [ʪ;x"[;5Z*o5|<|oˬ$GlO] yv}tY:>_Vӷ!hRj2RT7M-T黺iN֬~6hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF5s9xC ^(_ $ V( D`$6Ⱦm в"B/XxͶMx7mD>ȯEֲ{_b~McCKV'n ~gaBk%LmҕAn5)}VpGd Bݾ_t۷,9zzsxCuogEƁ lapmצU^txP:ɧZJJk^O_2Cnu".tx. K${. >?@lKo'&C߿ ?h&z~kƏ{G=W?}C4kɺfnDuFD$dI.H5^5F4kf/T:_WSYk hF58 &ҫ'Sxښ=+"x> fdT_WSډ: &Zk^Bm'NH翳^|>U۾8 ~k|> =6P ;"{yyi)_IlERRu\_֣i+'EZr_m>Z $~׼ ]q iHGEPMU謗"Li:Y#@7CmwE-~0≖肫F]mI~ѧH'4w< שSx =v4.'R*o/J;~uŖX yUzE}/%׉hwh:UU5M/JlAPQ]v!%]~^Cu[~Β䡯TOobNE]wښdvqC|UQwEmh⁦怪;m53bn****&W۬REFȶEMuSP<wu^eT6ScDE5ᅡ/Jk xumoŭ_ºj_5ё.ӿ'>0%U_fH~?nW}ϬM4hx&jJOYZ"T$:w>dhPPtڞ4kdG%ܛ|٧+ //ˬ txDkE5bsx(M﷗i ^evs𬶫׏kU#{}fn ln/Y$to9]3k7_O2]lfnmv%Ď -쨨yy0 /5Jmȭ]ltmށ?m.:@G@G@Gl.?m.?m.f'KBྡྷ'QMWe_nFe}>$~tD{ğl<=ލs OI$E̚{=Mei:TWo؟F$*[/Iq|Q7O3]fz$qQoeA%Oxt-dv$qToe%gO2ײA%DAUO?biNKKPISB 5V|KQSEu_4`6DOQT;Z᧒~Ma=$GWtM<$]c1':||uOj!x}~͵fG6%]|||IS[Gd} ]^^h[k{to:tWțm/kDnS};숨HuW A:[/*;n"k7l.=&{euo_Y:=&{etzM?GדɦO/a'ӯaMwMDq4؃tI$ttkuF|[|U~MoASdji&;mٯDO-{2WPt]؟ko=~*%**^ *xxk ~}ykStT_%_ǭa!t)*~jkY"GRF%MzշXR3"JHʽGٯ'~]f@>;?W}fF^Z*^^z_O&u5 8yttZ}DO+4>h+_H^]qPQU}B} Qu4b?.ᅬ߁>kΨ?W UKdwC]zw>4?F8D ղ/ҚY2Ed;_gOɬ^/kY}?GY}?Gh&i?&i?&SBdhSE]SٶoGVx~G#BTwqTEob} k(/V/ӯHzL"x'5R]@_{zGOIȒ$ۈ>/5Oɭy%=4oa(Ҟ{~Q-W~ >-kVGL QD]vQ>l0HZ).ѷʽ^{*}ZN}4 DU]Ľ%j[J*lR.{ B ^x?> /'t$8In'@xۯ(D** IG1^S}qؿ5_"*ҞHM9!E5U?LPW=vBh7^J[u* 6AQmԾ+>)TJx +6'_>8 (H("oWԾ)+VD|oƿ=l/R"{SK1BDUUU>kyBAUUTo"'XyE-ӤS}&E6DT]+t˯rn>zETTUO-z%M7l*%_57]yTuN>t﷼IoU>b6qELwQ]$}M컷Xut﷼IoIkQmZdOyfwߣ#_!~]~2 ''0 l)owYz4t|7}^W+ޖhKm])כzeӿ.uNczEӿ^ѷ^Đw2U'Woނ} Q?G)kP^tdSO!OfT̓kX[m#b]~ׅU_=de:'=~?]i_6|漟_8֛*{okURMD*2jI{U<5Q^hkt3+O?GFe<1]$d^dZiUvN/>?GvZN_}za^#`Iku孟I~]lM~_˯=&{ettkth7/ˣ~_ˣGl.I~]~]=&{etzMfG6mU|WI#t}+&xmӣY4hѣF4hѣFfh}Su:ǫoMSfK7mU<^wnzMsXoI~]{c h?GסSmU| #m6ն$jNқoW_Z4hFӗ'?7KOAܺ3Y5cѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4h7/Rk5G'/CZzn4hFJ#_u?7%[Җ4h7/Rk5G'/CZzn4hѣF4hѣFdkAԮ5 ?WY RZ5)hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣFcw2_&~/XdT:5=&ѣFy?S^'֜#5YѣF4hѣF4hѣF4hѫE2Ւ_W_赹{.󔴫dknS:5N2_<͋?+_qyϚ"G8\}Zi:jK}"<_ZPUE5u 3|SQ_b}Z$.ZҖF4hѣF4hѬ *;{WڟFQ[U|O_~xxx_koI໮ Me (D;xo^-UWokߏJ ##$TMI}<|~) 'BeֲѣF4hѣF4kZWiRZOX_ ~ a?O]b@}ϟ_ם)3[my1og^_s[e?_?wXI/ד+u4/֓k=ZK濅wZ~xxxB?ӔxxI{KPӘxx4Y_g o掚VQSq ?4m!H7$wn,"EMȿ^4"Sؿ]4T]U6Ww3]y wMĕ<|D !0On(>a**;iZ_ P_MB?o_](k.4hѣF4hѣF4hѣF4kf/T:_WSYk hF5z^*~@k CėdU";}$P|t]'_NSmؿ֣Ʀ _{<$*KJЉOԺ~]y)CvO=௼uVqKt`Tϭºڭm[|7Sm_fF0E-|X/hQQ5:b ~ͽ^I/_J&U}q#ޒmk|ғ1Lz=͕ Wa-tD|&`< !" mW֜=h=+Ԇ'I:G6ߧmw|hb<؉Z#:J!t.я'T:QWp_$k*m巇5ʝ^ *o≲&˷u(Q~O^ |U?sX#U$EUUtMWtC6`&zSt=O%*{>ٯ[ _:U<}y^b`/9 Cv~/_N?fn 9ז>B?o_](k.4kf/T:_WSYk hF5<SYk ky/榽jk.YthѣF4hѣF57!~''i_iIkNoCOO^1t_&}M,FMec/KRؑ@3a/C ~+'ȋæSR/ӦIqdDOo֒m][ n&mvw_j}/7M.o"kJUEUEMU6Qu-{Qaj~+ O-)GC=TPuRmu/[ͯ||<~ٶDzII|7M>β:n "o^|kҐ_OZ+T6/n(y_R/:Ҧ ׏&}EMx5 .巎ߑ>~z}$i57Ѭ׭4hѣF4hѣF4hѣF4hּUm6~k7MuO-cu7E-!oқ)Z2x.oč芛o׀ö+iV; ˰()kE6Oh65͵?sX}OiIo^\=hikX4hѣ^P6e~΍5S *xxm_FaX梣X(jD[mAGE_E֫]")Ԟ*xl8*]=)鯐,,EE-Y ⨾(lװlө7mTi{*!>)^.$~DWMˆO .Ų@[YیED?NrūQTGN_m7ښu@V:~K{}QbU^Шԛ*E|obiMC*k*$M5>.tFE uOQ?57]l'_X1"mnSEUvćtDqTeOؚADM:vE_}VMT_?bֲ//J&!okinQ~!|ɣ[z΍4hѣF4hѣF"5|?䨞~4Z~{}OkF`z{ױ-m#&?QXSoB}5)J{7T)4+}hO&z:>I2$GS:TlTU_kmcTT;h֮ij\<FecnOѣ^/c]i?.қ>s^OtOŸs ~Z?a}h~7RhѣK!5Kl17^kc[4hѣF4hѣF4k#~%Oǧ)/4M%F4hѣF4hѣ[ ~҄_?cn7_Ɣ54hѣF4hѣF߷7Zrr)?X~?k&z4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣFeMcw2_&tkOZzMѣF]dkAԮG?ks[RѣFeMcw2_&tkOZzMѣF4hѣF4hѬ?FJ4oKF5-4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѬn_7/Rk O_F4hѯ'W~k}ӟDw!CF6z4hѣF4hѣF4hѣF5h3W_?+Jw??Oe B\巳w}ZMw?{/{_"\+?X_8\}zj;9~]5ߤOfߚzNdITzwTDOj}.R+{t6[i/[:lF4hѣF4hѣXUEMX$@">緰&;SǧK5䋥7_o=8*t׆ u_y}<28*Iҫo1D-6mإ÷4M;<>-l{o舔yȉo$&-[!{8巔MMSooz_Mso}?sV+VUcJ:Gmᠼ}_C~χ7[>|iߡ_sYZ|7|GޗzޛޏtNZ؇ŋL#=}_OPtoӤLs2ϸ~ tNkf|ˏQ!WGn8neVCgkGQ!G+7_٫JTEӿg ) żevLǢy dFlaT_l5?0Te lk y5Քf6]܇U3("y mGE~.H(Pwe`t\I-Ƈoj4kiVZGkUF6v4-F.`O|f["6i>>w]]{QK}\w&5uF0`6XmScozDdžLsWV=_}1;?]+x޽ WOߵ>tzkFKNuoگ}ĸ(.dٮ9?y_tzC>iɯgPC.WݺjH M>hٙ ?$?Eۣf|W5jV_JLfysMcbgF-oQ, ʎ)ydDь>8(qI3m&;\W$`ݰy`ٮ7Ƀ(ɛ/uĉ_J8ƾ!\O* ޖő n֮mޢ!E|""5T1q_Yw.+lٺM4ة8H nfJ*ӱQ_:djrl,gx#ă'&\OGl̕DUW5{5L+˘T=={E-- ELyo5]j94z_yX#PS>yrռ:>i>5=Ԏ*ؖUԟM:tΫj eԷ/dO3 bqNLPHF|yKH⨡R&&k!낚AyEqg I5j$R9۵|r5m\5?c{.( /*'ל4 ̊ml."gDj$ڴ>Y۴ϟrqw}%P>hY@![2iPW $է% OB yN};v"Ov1WI9䘙pTT7,d1c=wMÝ}"Ó95۩ɧX#Z2\-,֌@I`ҲsΞ@֩־4hѣF5W?yWP?WW =M<d(U(4iD/uNuDyѣFfc+/ Pf/T:_WS[ZhѣF4hѣF5Яjk3m_M{?ֲkYthѣF4hѣF5+4?-a'I/?qu'.O>~?]xgkΔK3_km/?mWYu/ğy~$~bk_KwIgfM%_¿zbߚÞK OWkfv{`/cZjmѨSDMA(ZoL}Oڻt}Tjf웧W"uK<5RT?]!{ʟ^cMy|W֊.>5D&]UWۧ]zKҧw_]"m樚sߏ}W׍f7vkJm5Ҽv_g|F1u/T:ջ" wF")?][5WIgֹwb_=_WSX55<S[Z˥ eѣF4hѣF4hѣF4hѣFl_Yk k3m_MֶhѣFKb{斱]{{kVZ*_Ж֗W"~m7E=GSe|I'գ}='"wTy~z|vMFȾi\p/b~JA4>ҚQeE$%Y$ooۿլ"u}'ҚԜ6/HJ*s4E-QR/yDWmzGȶ_kҊݿ;m$6)Bjk⊛-2DIt]||Wn}U]wZ"xOҞ+JyV HAUvU<|7DKbj[*xkiUE7]ZUT孖CT|WëfhSe}Z٥VȦb) UmUMOJx۪{nAܗ_]{ QD/vmZ;"&xyk9ت*}?i߇I~k?i1T~3ok\;o1|yc+AIse҆ѣFb/C}u5Яok[Z4hѣ^55Яjky/榲kYuF4hѣF4hѣZsRz֕FԖ?J?BiJ_o/V>Dڗ@)N=d?_З. so'76wY'TSiPu?&oMө7]G{uԻ"l;'xo&h~Ҫ.ʾ ~fdQ<4l;(x*)ytE-QD?sulko$?GtO$ VMD3ߨ6UOOoy|.lh;*}NVxym]~оװMm_5O5Txt )*'ۯ檧mH)8OMV/zzSߣEW^m>U=}kY ]?Qvts^:ގxolcޒ"~OOoѧzPEVeM*~u4bQ@ seX%âxl" ]:mں5/FӨ'_&~_WjW);$ׇW+߁6Ǭo˜%Ԩ2)+Jx"ОՓ>0u'WCzm^=?4q\^Oj۩~ǖdC|Q6Doѧ GSwH>~~ HKh# l(lI4HH'O׭G/Ri$Tyx{U5Y} a7vk1V=[4hѣF4hѣF'onf}Z}ZoGrۢxo戾{~MdoC`E7DRdOXOS&Q~TWQ_JLIɺoWFI^ͼt`=>oҬ}jͿyugft)uuF5t_F7ZѯG~hk1.zZgW~iM?ƿ'W~k:yOֹqt~>tU4hѥMcnz54hѣF4hѣF5on'tk* nJ"AE"TR"%DADMUWO y"3!R3%AMȈdMW\ _aZ`ƅlOz=/M!$:[}q,H)0@q/Oqccp.I5y̜qRdM cj.B&0J(DGy 8PV5%d;$~7Qv6]|w p%]ql6}Gŭ$TvOYMF42<$6fbI,Og xs'U\CqX>礹N)p"ӦMg8E 06XwtEAT-?wQN[̜Y<~xͫy+"¿ qbH889zk@E]x֓aOޡrꣷspr]V 6rys(L˫aҪAp򐢈*|SW.aƜs+㊬4L)\PRKes,z l%̓Z7 T+?1qyG=m̓5,x~IʒV0KC=[ RWCeLTn-Tf F܁RQ_E,DA&k~qm=r\7V+e;93|Kc!bu6S&Su\ FviOOc\̧8ejSeubpڒ}."Eq v/g?J}Z)kI_P> /5^E]榎?m.|C߿ ?"bɎ_~]>'/5<ۯ'%O?'aEE^ۋ_Q<>~"^iW$ҫCwC0"['4ה%Uɭ2I'meeMW$Mo-ds{oWAUwn,8߷}khD_5mNM}7v_"]k̬- /#H(fin>}H̊vAM6mUkDbGBT^_4[yk26 䟶[@ᶛ"y"'y` [`dl Ҟ xmjvEu6Q<6EDnutEDD>W؉5r]7b&*Uw_#McVOV/UJggYigЖG)iF֫?F+,',"kh=I6w?e#UR-Fؓ8 N>Ie%Qr(L)ϒCcd:d𛄨"^ /[?2387*ʙYm]q{e8-kBG2lz!46)zfq_{?!{P9.^GݸXSqqA]"X}ҕ& YU+*Ƭeqǻܫ~pNFroWxsm}WȝO&EWLU^\ˆŮWwUP05,f1lGoj٘"7PS_чN8Urk%>#'vy'drlx!!*iiJDZqdt.=T>\$ç cnW?ٷTcwkӮ'pgp:+LʏǬ2i3c @"]UeՔzub$wl\k>%81 G'e] Lt-/f7$yU1uW A K)d0h}A|{λ/s~>fs.ך0= P=fKKZؙ u?1藮6kѣF4hѣF4k:^s˹m\:àď&3:ʾ!u+j* @+#ﰾ\Y=[˜: 5˪qWAQP_ ~-c>Ƚ_@Nd"bBPD9na$/uEW}>{5NfpKjs9kRaqe+mmH_]zӃ/01䘆AMclW^PXƶ>#n:^Ų[/'3nk'}Qس, +sZzEjO ٭ "I-/Eɱ!uƜT_ç&_xNQիdݜ[kW+M?X̴}pOs:"O*q/ ]FiFnH olx^j Zurjʲ|$YTdGROUU0bH0/I&l3 wMkC:yf[PH-f=nob$I˩{MNz4hѨtkᅨKT;Zz;vh䘠˶({x:_чkuCDM~]e~MLw)һ}?@뀻lm+E5![v~_^Wq]ؿ]e~Mdub^W?}C4uI4|S?‡>/z~k3*J*yxFԇNȧ>fcG"T6N]'׀Ǿʨ)=CgGOu5ͩ*#%f:xtLKH⊋.ԋ舉'[n~~M.1:Qu;&`s פ~OEȓJ̶ɨ I>EtWa|̉ob{Z"H/Ļx814oKom bBʥ[}%^Q=[_k±1]_gc䶿c hvyѣ$9H;tx{=8@=b:>.hJҜ";/kU5'Iyx{>enCixxh i@UF>>>nI͖ğG.Mt%d6_v&ގ=)H~ϟ ms߿_ Mu:JGHMu&JWHӚQeEEUOTկc^~ѯe5k Ģ+lGӦtF̐%ln1mi6S{"A~ʦbZF"JkO5Q^~Iqc$(h&‹4+Ks/K'Br*{6֧^ޏk'R<U7ojT3MO؉#":Rq<U4ں>O~ x[e̽^k(⫺Ӡ+;***~G<|QwD5%lI%4^/uPSO4Mb%l}%Jiښ%"3\FAUQTL=?2D).8 AtZ'/ľ_ncɐiԽJdå)HhAHIú}EHTiOۯQȜU:w~gvK {* mxyܶ ԷU]DT}Փ@Q-ю*'*+Ȣ=Cᰒ7fo!ԉlo6˭M1R_GsW6fJGY᳉(]M鯆xM\7I6DT]7M{pPM|7ED}]n8O_կ7PUw| Iw__b})k .) J;*>[Sٯ(n!*xm'ib1QIz<<:SdQQB$MtE]~:ҟFn_k :UP]]|QϫX$⏷m֥2"B!xOB^R.PKe_O4uP3jC#AEPM__n:ԯqhmJB;i"J'ʕ&{ul#}l".KkZq_x0pRDd[*yרּ웎>m)l{˸^?tpDUDwںѓ& H)l]C+KH({<~EtCeu 4ڢ쩾/mUiMm<{^<6ٶߋ[ᏒUCn 羿P7|K΋B["~hkﺭx!t_V`!m\Dߤz_ZS%M|wd^UW~_OeU?yQU7f֡*)}kО&?_[C=>ߧ>y|cBJڋk`"H*J~;kIKte__^eEaBiSAߨEUS%O4ֻ4B`$ҫK.*{5Tvc:t8FE'Seo5_]jR&~]k0ixʟGٶ*R'o˯M^WNxEʊJ//4 ݷЊ*aU_/K੿*SBī>UOf+@";/Wb םcѣFjk3m_M{?װ_Meֲ.4hѣF4hѣF -Pxo/4K(Hx.E^GSD܇<7UuE v$_-T/TT_g/IzeO?-~n v[_Pc%AR%6ISSZ0~ĪKᷖʪ֛4 * Q.鷖ʪ@"l2Wd$_My!MvMEה"%'u Su&IDDG<o<uq tgDmy{_e~M{Gݑ7Dؓ}|ud/K)"}y<w]{ t=M|S}|^W=-.;/UmU״OO>""""{ Q2Wm| k7Q}?9$# ]'u£(*H^舻J*r"#;غ7v_"]{]{n4bUOM|Gzbosߴ?Y 7/_Lw~]> 7/_"bɎ_~_ˬȌ wN_$O=}:p"x7i.݆WzmTԓS^UOgҿ[k~`r3" *mBm ̷_`Rk6?O0{[o_[䟁5~_˯߇gl.?m. &ߍƞ* fp8{_((hJ>Ko'2{/ӯHZҲ0 'dWà+kH>[{˥j!W~''{X\%/ttEEDDؼ6^Eh&?G4*H*x5EDO]k+"l_J[MDo-4}%hUx+}(~זgXlIzl_V2- ~_eL.b 9ҞeQWdcQ=C:SxAij4F(*lKomY"A: k_ԣշ/zQW*u*z}]k")W﷞IT׏GK_uBPhr "OfMg/k;5b l(*'+MyքX~__o۩|]_T:=>xm$&f`oz{}]gB=_-}SdeRؿcQ^>6O_Y"bɎ_QG@G4|O_1|C߿ ??7f&;~{G~]'/F?~([~_˯`oWN{oe֤X /Wz?nNLz;3/:zn7ߡ<ݺ|7~{֧S䶿J_מi?&~-MmY_|";_O'׃lnmT%OZ>utﷺ)oQ>~?gq6_z1]Z#7揇gxV|26 䟶FfW}ֻʬ~VwmN) cO7z8О{k}׿ccZC4@dOؕ=e~M~V1] J KX>Q?%__?וMQ|dۥo<^^nkνzMl.3!Cog54zMdDO- #Jm]`yUOnmҵdfdzuz}>^d}SFk=n~&;9F{GvѣG=naaɎhѣQGݰ4h~([_c5on%8gֻշ'NHF3}z-}]u.rW\!&dܷg"VQ߃ (ws.Q&ԅdnԂ_1h_^uQx#qmN3s1lvtT%!AEDEnEx@y1AuTSk?w1%I.;zrZ[]UdL=Dv`@TE~5x_rWp2nDcȸSV=uQ\egǃ$Iiq']TE~Nˈ31^+2 bY5'=1 ?!GHpHWX[>a1p`[DS5ܑ7UODӹ>>Z̢&aʯxʘ(6ʹ*8r=V`tSv1ǭqDkVb>c!^DUOUM#sN㜃dE>WGeAb#4gd+ࢁ*˅2"O_jE῟/@X!tl/?1y/hl/?1e~M~]>&;9Oɣ~_ˣQGݰ4uI4tkt|C߿ ?掲i?&Q<3ۭw}<vc3-wmRUW_ѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4h7/Rk5G'/CZzn4hFJ#_u?7%[Җ4h7/Rk5G'/CZzn4hѣF4hѣFdkAԮ5 ?WY RZ5)hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hՖ_Xjx̯+uݏQ?\O(/Լ7I'Y~9{9s^S/:aң^_sYy])f[/a~~˥&?/?כF/׍n/[4hѫO?5չ?X񦩧s1tKKu_S-ť]3p3ɿ,4K#4OkU0㖴e~>&㍯]ώ_W=ֹ++cSsw;>p9_Q/g3EOAkT{#Eesި(n᯦ V-f? f? Z=<DzmVH= 'J vֱSG,!7[誋rZ~.|BJ.2f]a2moljex4D@__˓]/4{M6GӸ /93av,6M|G&[Q*fR!eW&rLƛ9#FmPdG^:A:7H*m5=%=dbӡ/R8.]3iÂӊk>))_8GPsUSO:p6_{ʺvmb?6S`L_Lsw7f?x?sT151WyG5_}_ׯ/;Lr;~ĹcہXe̕X[Z!^'˛:ۀsOv>#6I؜~SylxlQuaHi42ζO{>i8Չ07>4ͥv 0"GK&Kќਁy4{#h9&l{ <#< lȯ=l.Ezɲq:^iÎ`o|yC:,^9aɹù][%uͻ%Ie2Eu0[MWz#m^ڶLV9>sbZݐ-2x ghcxă#_!4Ц(x"x٧_vݴq1 LϜ;1Gsf;ٍCV.:!Xd̽]R]Lp_oF4hѣF4hѣ_+&̔ {H{/˿GN>{2ﳾ^8,5msQV'cۂh͒ͬ +^%H'D8)`wd>CufEfߤ6͂{!icȘ=,l `ujId2 ([ykXwPKt+8%|f0@*۩䪚Yro"q>_e|e|&aXïg2[jCb3 D<_h_wڦ{ʹr);aBtMA.8 )sgk4gl('bNĻW )|=js;J2ʱf[)"DVȽ(^$&kgt]/l6Gg iCqG]z%1y79mlA60F: ?4j(ȑxKPp_:{UOSn?Ls›u> B4ѣF4hѣF4h.)Q|~M~E5JoGQh+ U|vMMU6׍oɯ6>R'N]x <翆-`Or^Ms^S-J쪉>;'̪ԛ"m;kBJSI,`H>}Ki# 67!໡n"{?=QOj{~--Fud:|StҋDIt'խ֏ U?u6>u#u"Iầ{u:Eӿ־5^4hѣ[sT_/.֤RhPSu}y/榳ѷ+һ*i7| ~]eUurDzvBOtDM7D-Md/5DM8翱t7,UwO-)kH"y( yI=JK&@^*{ ѭ]T:Ҍ)xᷘM%*xozJ7(QQ9/٬ ~Mohӟ^hѣ^ q:A:}DSک]xqqIU Oj/ӬNNꄋᲧ o{=_l~}oסC||=,oЊ[.ʩ/ѯ@!(*kT6Y_] Sd-}&Wx*+R}{;"^EMmר HQTTUGÿ#en;yߛ"YeQ:IQ7FOj}:ȭBYQQvGڿ^O0Q]UTO/@eMUغ}E>_7(;ׄlԁ7%OUDM<|v5_"MڟJ~x U7Sҏ_Of^ln{o5؞izwcXmDu%EdouEOwMv-|U|vדDsd]Se-}ǭ}Q|ïP#2 7iGąSě_gטQPTU>{wubipSO ?M1_ʊ*Ex4*k>4hѣF4hѣF1U%:U<|wE"،j*aS59 .Щ_hJ55ɶȊ{w׬Ի.[&Ȉ[zE$N~_s6UMd_&BUw"%}+y"N).aM|6O52< ϧTEUO2x(mk&^#V7Myx}Z#/ѷҮz4hѭ DU]OZW`EOߧATQO} *m総_k@21*:`I6UW}}QMG<w z p[%REAi|=KB6@?Z{p0ЗB*y*{vuu^_^ٖB)**%".Jd[`TUOO؉k,N%nEWokPiF7|my/榓e4_GB}5G_즎?m?.kh׶U_-O^U=ADMk6k֍4hw/ZҿOu0)¾>Yֆ='?{cthѯ`٦OѣF t_OhѯMQ?͸h"o_~5O˭gKNEXadm2TT_->?N)2!tF[UȚPwAUUUѥي*&벢4jʾ+'T eT@4RlEUvMa7[,*)+m*Bi _Ru{{}ԑ2$$\Tzd7EM([Qf)"p)DX-Vȅ5] Ʉ{I 7WӮ1'R.:n.z[m߯}$dvUU铿Q4d%" [4*}:hJJ}zW6WooҟBѺct ɺ>}_ZԊBEu 6_Bz7ogWП^~;n]_GѭmoF4i.G"=*8{x*z":֐ٟGBoV(};y}߷7IzUַývh )[aF—>h )[aF—>kaJp]7TD4ś07Uugf4nѣF4hѣF4k#~iF777=ɭ=:5F4hѣF4hѣFO7S.4hѣF4hѣFdow3oiR[!M폃w?^ z\Kƫï}IMATyǷ~Gs"`q߅n ЙX׶`zn8m{ xa~-^G^K.}]Qd5MU_Nlf)Q"l_/!LZSVS"+Nw4+ٿbs.8i/䈴s)^q&0Z{<pa,dD U4bxw"v_A]x'^AG$ֹ:;*毤;?xTQPQ5.fS|F7)RxP2:8lr+ܘï_Lvz96訢"i^Eeu'YlYPUwܛSEVUS2vDžs.b&*3V%fػ2(ʤ_D$q*&(NS_/J{HcX7$ {LÓ/(U>1[v2/% YADZ`#Uv^(܂,Ye|sHu5oNDV<Q<4opGƉ4.$u;:ӶI&NCY|1G환s% s&K~>GSмyGP|5jʺJj**ǯutm CiADD鮮 *جA(!EhX8xc2 ؈"""im@ ؈6b &ȉRux=SYCCI%U5%,upkj`(!Fh[ilQ4߷7D?_d֞5F4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣX In_iOI4hѣY+?hԖnksJZ4hѣX In_iOI4hѣF4hѣF5R]f0MIh4F4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣV[ea2v?G0s$]s#<"z>#I*j (l]}sK]\9qFJ)Idɔy}ːÚȚJeų4c?!IA >yuG2K PCJ9UёIJ(D}U]ۧ.'q,\YYXLsίT@Ю #VOA3xE.|k|-a<=O+x ~۫0PNN;lqQh[~wY}72Ǎ<:%ǧcp2X n/o2UQ:81 GpEm'ύ8͛V61UVC1B2SرŁ^܄DUp}ERUkUqBy^8%[EdctV7GiM נ pe /z-j[\%lPUnndXuZ~dd-@N8d(UwScEcK[4M=.tȋWStq`E:t!ˆ˒eKlFW}!mU"%DDOrGr_֟/~0lo(=|I Mf־ u& [xf;$w-&lt.=T>\_Dtmus6U[ʌ_*?N933u\g(p.r+K+,c[>3m>!ҚDK* O8"(.mQxQF1YwGYT\V?ƶ+̸&⨺`²&[8MԨq:\bLg_e]HTU<_:8[Y-idq.r\zj;y0*l<(m?lIVt97w]dTvϦV,>Ԧ]uY"fK!tI∺n&Gw]ܦAK=|sڒ˯ȉ!8(`&I∺iN8rqSJJԘwRVj8 @J誚y]qܯN2|~Y,b13.8̤ͬ”,K۠ &ʈ_c"r:,Cr޾ǩ!?cowuk)Uu"&N-mT5cXAd4)Me- <~7[]Y]09"\ٲlHNɳaÕaa%P`vTr\cƌ> bJ"jxOeP[eY~[u[c wWځUQU]dͰ4@*FdO&{Z-jyU\{XCYuWVW^~<5=< #>RWX܏qTJ%1fEvō'mdEZnξ_~2XVo~!mm\l< ٪#H'_}ٝW{G28 R/m/.kߑSiȷ2\ @yGzIo}j_\bصsErNsAKWTձ>*oə'qOr"%U_^|~Xfy5p4lL..GĎVR~?E:^ʙMY.Ky`z$Ban WaD5ycùqs߻[Blyme\?òJX1[Q\tw2"UUPnc8\߿TgX83#KC@}V>M_3;Ny_xOgɯbvԱܬcc/Q5/̣^{ƫtל OWP'\OFl07zB6{^{.18E)l5Q_97Q +iŽmM+i+X.+kc;2t1+&f98s|^1++6مSԽ]T0 y'Gu;yg<]3'ׁ7#:Υޛ '$nk ±U j"EMzRou?@W.컱ʼd4Q|Mfԯ:7z 㷄$2^sTdG ᒞd[piXey\$^moyRʐ߯Vcҗ77=w'iFU}SX1#f/E2OQVUm)Ն; ^2^XwpFEbؒ,P+EOt]bȶQc9nz_2;7Do.k[q,`!0[mC7%4:G :=H;*_ +CI dMgKi>9},SRuڎY^wn%a.%"U :Cg lBdVyU_r^5m³ _}"KyCr֝~5~E]Ƨx[cWFF[,A2ͬ)BQDf{*c"pW~ 5u ^?޹ lpI˛6K8 \Ei쪄@{|Oo% UrX MPB>(D䊌z{N>dgCqdpp*8#p>vq${fQ%%tuiUDZ%*hѣQG3DƿZ{ԟگz;qd_ޓ?ȅ~nƍ4hѣF4hѣFf8M$=[.$i5DU]v}y&(x*5d.ޯ;H9ec+\ / ǫ~*Ns~- 4oOq eu>bS( #r2S=~:؏7( !p E1wN Zv/x{ {/_/)|~w=vR^p=j.E"g'"OQF3R-hĉ8烗m򽄇 rhqMEx.<5$mȥ%]-iQJz4B*pÔg]r\!j.:HP%%O!od^ڒu >uQ?!zTq:[O_"|~em)ھio}p}$,Mm8D- t> Jvʚ)@V{^;4RS^o΄%A2tDDD{{#y-VUQ2!D5)/{Iz;wT @$DDOf2sXycV[\U[œfF#F;&Os6;f2r޹:ߣj|~c ^7Gm)D"%DUb'pY-weʴy,7})WϢ5&Юb/Fþ=U(WYy`RpqB?Iu$E 7TF8;=IV&:~dلMIu$Z~I pglIHϴ~9,[4In 􏗵v:Իrh*1]e3g5=p!0n W܉6?J%9fJE% dgR \}WQ'P 9d~mrZuybX-eJ쇈o曒7"i]ATpTx<_n\}^Q{SQn6:Cg./i8| \=mmkT0Ie"Өa~j*<.ɱ{z̃Օ=<,+- JrnzRu:zLUEb~0fK$dC}skS;#ˁ/'mIeΞTU.H` 7y$Sq#T7Eo;?˸O ' %S|rQvmVXQqi }BW;x9+$²_פ,*gmd!WkcUGw/]@D+荲d]&;[;jk'KOo~Vu~/_z~pg&f4xG )kJ04_Inz{ <_'J}>}Q?~ jJni!ʼn?;q//`Caa/˯~j?G]=w'c<;<1 R@Z; 4uIr JBmSw|<^,3i8-{pr'g6TWW !m**t&xbLH ! o;*m櫯ov;wl'[Nj畧O@Ĥ\Uc5eK7lҶz%uTӥQwֺפ}!ѣFx0bd̹2"ɡn\ayX9$QDz$vCȪs]Z1r7y|eKnd O&1R{">:0AG}O7ܗ+Tq?3G97WxW Q\f2.?&5/qؗnñpF PFn V /JM{ܿ2֚E @lAdl\oU<|pNwIs~5^ lu".z'ʞغۿe#SZ|oͫ|s,hwx qR} TtS}Wлx4Z˱]xŖ I\+XnR{*oˉژJAt[/O8?N~+K[͜G;{c*(ܓ(8k۸ȫ26ؿ5Ir}:Hwۥ~8 8ً- ੯ il6HHUDwEOM!7í.̼ Nbnu**._O=aߣA~?.э2R_}1;w?<ท7}ӊ\81W 1o8<m߂~}Ξ T yx?5[p *\G ~k+igח!/tuᚑ,46!yjOo~hlɧ`_6ù~R~mݟMk_\mkQѣFjk3m_M{?װ_Meֲ.r#LV|W1fa0;Z{Z]vFp Q؅St9NGwvΙv5=ʬNF[e׫n:5%9[pE0UU7MdihI7BpSE$EOcc8ʸdz>'>z0܂31dIʱ>+1* [eq D1!UEl֮S?Ζ7$kS^kJ4_u{NZЏe&ƺ媸*mI`R^;V+,{]qWss[ɜG[rZHwM6{&Wr<=B6B<ÍHsN,9mi$4.v;r*pܮl .㬛nKJMxF nl0 %m]1𬑆Xzh מk@ A"+"M>Հ? ~}_SVk?}_SGmt&[己~5Mobkk([{_=)ŬZ4hѮc|׻^ػv3R2~iq _W%v~ ȷ2/kղ tsKϼۧovmYgvOi̸+>,k!ga g+c׹ = G C'۷;p?Uo~cßt?Gos]nLk'.bB|CHU?Z?3~;Wa}oKGYv?G^iˤTm<^z}unNmjkuX}?}އ֪U=/%ٯ~_Nkm tD_=4uvU/u|~K4s\?Pk J.Kb蛧WQm{g㾝i)]$EADuy j4xhțJi *"u警c#&ȟe<4xyVCw+͘ s#b܃}b5,q^19+dͶG\Lj±¯qE$H W]gǸgX8ϯ1LF8?,e8PE.c V /BU{njr,ŌږE @lA_8S8Pa›phrn?֙Ci_I{ 5R?`ߛ?v[R;ف\u/:c7={8,չ94T+`1=gbMd$w_:R='mA!n]I%ɷ[Qm8 .hb$;***7hG&\Q !EESZ-/WoKuA_ɧ[yeyi֌\m0qQ01TTTUEEӭ&ȊֺAp:oX<|obxy JֿFOׁDMnX6zZz4hѣU̿"۹>,~p~弿H3ȱ-#MVpwѐ9*y}ӕ<'Yv1kgِx.AsKa6q+(M9HepUErx(J*Z=r_ĝwm{oqlX=Uɗ|YտwplaDW:lRm#_D_"¿Zwb_?f P'l_\/ngWp]??`ߛv[Go1&Vz?q QG1]f P'l_s8'cXX(鸭daћ06\WƝF!SBC%ܔvrP|{pNǔ1QqZ,3d؀KcnM!J; ~,vة 'ѷt3=}UN6-1Mp\O yd\GTPRqGD͜e5ʭ3*ۍnpfOLNw9º_H+#"2IM_Ͽ+č<#ʭ*ێ-n0fZOLNoY _H#"2NlSeQGIS/mp?XQ6c\Iӯj#lև/T dQ]C8ilxUoj%Kk!GE)3yIWSi^B+dvާoT93[ ̃c˛<2^f OS+ޙ\!u tFߤKu/ES>*̿o6?&÷C=]4y? idXc?&=S]cZ8 p5o5h pd[3g8"\yk('As0^G;""~y]$E+Lxpz/M8a9U^aqU6$EMYmpTI:6TnK`|yϕllw!\!NPՌT?|Ÿף[^ˌ^)I|\QKik? ZC_ًkoOڏrYG.`? Z>6Wb?6)?%ZZ?=q97/ef/ɣoOҵWͯNN^Gեtm0(SQd/Qz%? kj֫p6RmLln/MSZQ׫PS~n-ݤ.={Ý]]?4{mԾ[irh''w2A0NB;GWE.#z ҹԫ;[+ϋ0n?{UGf($q$h}h\TAtI#[NS$VFP a#a\#I#eT*ި"sKS,Jj+"?z=u%F i'pe<3(JBFP wq8,@'O/R}vާwȸ"wv[-5Yb.M[J~K+_4Qf|'tAGAK|]+wzS_4vc%?DUe׼hnȆ"8hV+\^aAy_.QE}NO;7\>28,anH0Tʙ}<B=s+_1&|igG=_ rsۏl.qy*lgO=8?yUuQi8 h+(HHs,vۖe;ɬ'[@U5SpNH\M\Wꐂ8""+g**{/Dxp+ GcO_Ůt)_p]v_\w%ZqfqyZUc]A$[0_S(h*H_6|'Z:l۾dֶ?s־9?6*-|'Z:_3>nrU} լe ^շVG]w͕tZ^6mJUXZ?TO(u?kk7Og14Z^6mJUXZ?TO(ta7Om?uOkxٷ(qWahmS<0ه|? ~d{cGy?5f_|n~\g2+?e_E^Uq벧ZhhԔUU5NS~pu+=a G=I.BiU\CTMM+vlQ&-)cІz`J)k{/ӹ\U0178QRþ$[4t3^D#t"Iw0s>|Y1koa^GWT?imd߂Ӿ^aΞTWewo|p XSpzyeetσ۞]eΞQWŨoƮ'%1q4 .]ۮw9qݟ*{} Yk&_qnUVu²浗\y^umHW>p1#Q'|-}py; zv=[oBw}%u`__|XjQ _#4C0Gv{d/W7KN渳CeG^Fq.4aZs%[SgƍOtOR }pos(Gʸ- J<3P kb3XUzrX?dX&҆5\1wi܋~#e_{~%pϮ1|~M#z>Nxtß`3>GxUZ?_?V_?> X%S'WHtļ^cq};3?-Gw?tzvM|tW/s<~ea1~Wp ǫl2OF#Owp<܇oqoQU̹)g( {ҟ}߇($`mm[ĆzF=_Tm[YϽa]r;s<eEX&i% TW 9][MLd>ڳ_YPl nISAGAd%$K5<bu&4pg-Ϩfj *Đ/H*ӾIgv)o0eshóyC ME-U.99 f0,H0!sWR&F4hѣF4hѣF4hѬOV%ƎӏȐ 0+(M6*DDk3dHu#ӏ> LB뮺j M*"&!R%AE""TADUU|5LУH2C!a2Iu#Fd$>L@fJ"k Vڵ 7,d;Ǔ2%&%eq5`fnG|E~(dD$M9 [{ayecKUə v,A9_) TP?,qWЉg Wt3oZ1vڨ9e!O4EHKoy_bksCU: ncʝNleGyN]m!H|`JVH./${[w!82M6o AhK fz~]o>l\eb]r$R8ڐ_'†ЗSlE\A!μi̵XfsffnS /u%h" sdTګ._y}wG{Mp]c}mE\p9h{_鯎]KRϹk&g#F_QhXV9ol&=mIlI"*GP 3>u]l#XkC}&# `]%&ʈd!W!X>(H0/jOFc3wtqq V6GhbERw۽N,w,ۈZԌDf8*&/V)~o}qحwt|ˍH ܤuLkn%mr؀=i93ps"arN!\GQ>t{b%iNq^pn;SI5R'B0;vg7M{ʦ?M]|¸#xMK(z3y5SJtQci!:RdMe b)e1O|-+_ꨍx#v8d5*nXԾҤ\R\m&%<7?/pزr(]dܗì7)+K?1Z~{.*'G_2w~5mukiNQc2S-[j2bs8'ku=L1ѣFr ܯ5> <~6O݆ɷs+2knͲ/&f%/p<ovqonQk̸)>g"'agz47xz9oӘĆwc*ox}Kl\so[~๟[̹qJ!(~\F?~cE5w'aM7w]^?K?%e? _P?0LW֯Sո_[GWdR}ssgWf5g/pD$z>k/Ȳ?~?>Ob_B>>V>n0sڮ[T~C p]֏xyW>#~}d7F4hѣF5Ak^{0nlc,ŧ'!\O.̞.[EqDeIWqNq)[՗ c4d^yM;oMc$]v4fDEAERUÚdM -"ESW&:Ho9?zeƝsEŘ=l^skQaVev|TNFGNTc0XPEJJ\mw|5O{\IaS$ׁ"k_ֿ׍҇~aoCGe$@0Wk4Z^6mJUXZ?]_)> <?_GI_DOkxٷ(qWahmw|4['O}ʞ%Gy?5f_ߘG[o|? #*yd?Mֿ׍҇>]ܙf\ʳd#&L\%b‚ڷM6&R]cʝp r䌗1h%^^Jby#q`F nF~Vۏ[vVR TQ9 @I[Ql@`OO-}|yxv<Õ9+8rYVU>-l)!raO®deFlT[ETUUUzyk4hѮ%~-ӃykMvk`m~bPұĝ[pP_\ @l!Xq&ד,Vqbséac^L-"  4ڪ&u U:m#M]Z*VCq7u/E<БG_82/{uqےqf7T%y}@[RX;dԆT&=7<J:|ybf>S>`\O pے~er\N:1ODb@i؛cH9#>bϾiӔS5;-X|#)~'_7|ga>Et9wKڋpz'!66 ]bϐyiRSh>/|ÐԦ{Ldes%NěȈxPn𻳊RsƋO0rvTس2<>?d وeyudc~]V_2_}|&gx.=or#`qM{WR&F]n7=D\_oE1T_OК?{|oOR;^wȽvٗ=}g\ĘnUQ޸OUPludZ6c+8߫o Is<$ǠLN))cICTI 7VcϞ?#3 ;~>N3>Rq̖JN$ʚ~"$iq_WZZ4hѨB' -kPN*uMDUQ iETB77M}fǶ/m7]uS]@Lܻmnx&=$|<č; \wGP(o]5#BN<)o.ۍ3Q_jQw 7W0&fk7T~cE4p"0Gv{d/gsu8sSw Q9b8 3MhҰ!!t{\ f49!sa0s1,bzŵe&v1D)y/%[mtyХ$@XUT&$$r$(̺$vw+~ۛb^#ɜq=Q[XYLq˖p~钍)7 GPuG/~*T|5DD"y=;Ͳ;@l^ (Vu]Is N2Yz;=.1^_yvپ'cVS'X՟Du=[O+(+|62t[7 cOS!RZˈ.zrc@}uh]WoTgOr%>UgA/L ܫ#ƭ뻅eMemk/|<"fڐƯq1"VCm_|.Wz_"=_#@m|ʻcs[x-QX1牨~3pJk wMIo0+ nۉÓk^C*_3,ǰʛ qSo>"xe56?_/"?Lzd-~4_I7e53?gn^;W?Z_䏂V8/*? {$9&=Oi[F`_UOՕ܎4kjh.&#$.ț+*=[Ϫh&!/tk9^ṇpLYk8)aq]{q} 8TQRVQTy^NS>ݰÇ)NMe85::Hr-j04WVb_-1j )Ah:mcf鶨N EЧu}vr_mܕiřs^ kTVfb|SW>GQuo}LP!!|/sI-/S|}Z_g|j/pY"־r|HYEO_ֿ׍҇\SKhe=#@0?7:L2^oPrO.`GkSs'5Ⱥ?6*-|+Z:?)p־7:L2^oPrO.`GkSs'5Ⱥ?6*-}|;^'"G xU5W޻+zŦFINiU\CTM52˂țwҖ'NWeȵյdN!`ȗ2dba72UTDU2d:r,%F gN1Ç+DR@x33$UUDMn@n`m "*nҳSQS] VVaS,'JqÊ8bJ7M[h86m6N)5T]gO#22+Փ]bͼ1lcsBz>`u6Y7]i>\fGuSDKrTc߯ygu:a4 jm@ Ҫ"*BS7q\{'iT`:dFQm|r_aֲ->/89 #REySIPHD'MsXQg'<8"&*sY_lC!"""f5xUܟ1tU,0MVeү+X&~[ ^>DBDDN}ZǠG1ZbiNzm-e@![A\}fH}|oĻ6SDNVjRCk;+auó*T[E[&G$#Cm >ʃz!7:$L7//8 cvbWp\g]05~m`J80Fe{ 6aAMb57øŅUU&|a00%EE &SIUcvmij3:ζs!"$R㙳"4MHUQQuecb[ ʊr#HlaL\i֜ qQ !]S_e]ؾ?>Y2 g&ƵJn;d)m%֕N-4hѣF4hѣF4h&Kn?qU5WJDJ6ƍR""DDFAQ┖.Mo]Cgsum-'̛2Ax*D2dLJRj4h퓯m4'QJ"(*nf+ضAg96#b3or\"SGEM\ɝeie5bÇR32DDM|wsJ[L/J47/r @CXvH(*]a)+JWY}ֱÅ1Vq\LGC@di.(U,_IaQxAH @߇ O!=u4ח\y6MDvM{ʵ.Y: oRe6Fݸ>_ЈNq{93w.ո6Q+ഫ#LAƣ7v@]]\{+8~9B}_0F ]fv]zWw_C82q٥"$> 6%|>f7ls^Lg+of6mn&AL$}7F&vM|#mڻ0xk%nj_M|:ۍwTaf\g$Bbm!fql/T Fpt t)6[.Ī'"_ 9㜑vrYcʘŒI *n2Mƞ.~:4hѣF/c^`2~͚s)LskaW1^~eEj`_޴S͇nS풗qsl$Jc"y[ \^Wսߨ=y +9(,j |>Q$Hbڷ1 62İLK]WSڮArxdyP7!']' \g.a,pA"|7T~cE4p"0Gv{d/otyv=Qg|%k/plʚE$g_m8f[!) }|{;풛392|;5ffAD[W 2 JHkyyV(Mirx[iQdՖiU!^DUE]}|;{S`"чgA[K2\rsU% k`Y]KgaZ3DCS毶MuF5/xߨw&UWb'|$7ߤo69?CԏWA|3%k6{//S'WHt˗X?||_H2_&Ɠg~Mg(wy؟j-%ʟ9߿ȏϻ?[|GOM\g.a6pB"|7T~O]_tݳ<_OΙ6]oew0zF!$z$j=Ww˽vіe\ː->qBǖ`|)KE\c{)T'SQ|E]e>:[7ač~6#; u/ox}%rsgsT_~gb\[Y ).r!(#V륺ܝ4hѣF4h? 7ͼ]\Xm9 "rOJE9>{sm!=AQ>b~awWr1]V;- :VTx{~{ceC6iU/[8 "%Q/ͮ*CB83ſZv'c~s5m2n[;p/?ՌFX˯F]#ih7䗪#"3ߘG[-lOZb*yd?MsoPҕo%Tn9+wI@$z[j' *x* }G @$wEmL.cmd*૶7ҪF/HA_/͞ǝ f_y b"]Hl=ɱTUR'c4w glcm\J{҉չ,߻ݡq0[.k&f#o'ZCĝA^pS}U"sV{Q^z"؀! vx*jhCO0(q(G|pZeNzO܁FDmB'VEw ehfe9j J MudwUK4T@5W{>y`s  2~)pUAp 2nDh .@CFwUP~H3 W:Ժm]ҠTwo#Q#Ln1 :q <S(7QQqU5N;>q?6"˚Vr,Ɯ>9+do*zBmgd:VGpqd\?SeFimÃc{_cs5f!:m|;V: '4,LAAWEVFR\A}GW_O}{y}5Q1܇ejs=c8vp,6}(5=ZլѣFpkqpk/vw}[X}Qk3uv~r^A?\?OQ3t}^oNU}d^qCeݽ?\o㯘?;5.c_'a]m~NC?V'i=..??/ֆo|? #*yd?M|Z^6mJUXZ?]_)> <?_GI_DOkxٷ(qWahmw|4['O}ʞ%Gy?5f_ߘG[o|? #*yd?Mֿ׍҇~aoCGe$@0Wk4Z^6mJUXZAs-w|3I`,wv`4PQj~wH^Z}y۶y,39ϓy?Z-ke?QAˮHU<J,I.䨉7~Bx&mG 5|5}rZzQaπ[H`FauTv$EI7y{ W5P>徇 > &b,GU6omlHkaIY8s}HlɿZwvA׭H|Q|:9˕ml <?_GI_DOkxٷ(qWahmw|4['O}ʞ%Gy?5f_jNXGեpm8nGfTE^IAO}Ge:ߚ}ji\,#mfEe ^IAO}Glr!3NDum-XӾ;mi>}_6|ys)$ ]_#uqDX[/8bh꣞xu*~~SlywdEǙl$k*Ųy*qW:}PE-7컄'Fc0(߬ .G}zcXm.猖#7k@U6U"{+>?Jjvԗy-q'X̣+9 %@7aS*>hI_{\ n%#" ߾ڌYw,YOЭX?%(>`ha^qxϽꚎYFzuن. ^Sb;"8&؜S4b+2p$"56" K)}x'Jx.bgW07$`OM[VL>Kҹh>ݷ՟ӳWF4hѣ\9?e9kZe*KQ9!83ܐ[WG\0ۀO̳UrnTrw16"U5^44e5\i0N1!Sp^]r& Ae>Aˈ DREQ)M_o(N*m *1zӌ3n  9_'Ǟ+[ld qZu?'}a!\ODnqq'3 :W"ORCTP3>NI37\8gYj0t씲$\@|+.U01 H?Va.KoM|󽬷83q\pe:<=0'%!1m<}[ukTD۵g_urFm~}n;xmauuur7F﷧mi^Kg|Vڥ_|_W{=Mo}._GzzvmZ>wĖܛʁ@g+劘+2S2(U2:Qlo|; 9/G)M&VF){+rġ=b /WE?.. ZQY (iHJ`Co]]^~3^79-ӓqsǜ'`d8FMnu~(I|ָCS2K4ݓrrYa#MaljF̓B/ٯ̯(xuCP~j=7pxv=ϫM׿rD◶-zQ[d}."2*˹W`QZ GLq%LrMڎ n7Wdv_ɞvφ g̸ٟ9=zlRj@Ep_ǿ?Xk?oE1Qgȟ43\6ق>n '}ǿ?Xhm_|.Wz?DL? ?`__O+N;튻&[r }crtaUԕL{% zЫƼf%0rR4!?E?.m{CG2~#r]XV3@<80QLdKe di(؈JY0^˱x]SEcFYl("%&k\'fl4uu\N8ƍ)š,@WR.F]n7=D\_oE1T_OК?{|oOR;^wȽvٗ=}g\ĘnUQ޸OUPludZ6c+8߫o Is<$ǠLN))cICTI 7VcϞ?#3 ;~>N3>Rq̖JN$ʚ~"$iq_WZZ4hѭ++45  K a2<[/KLGh؉K M:ؒgΖt6NDKL0/^pm]$q/R2U oj KۙWSM]Vvdeb,VL}+7_Ybgu4ǫ!sq%R_\݆Sfuv7IrIEOXl%}^m>GQ-,Y9ᢹ%c#L{ڠDDx!t5Kϳ| _0lOcu6V;}s֗rӺo^\]uR5m\g.aw?Bhf0Gv{d/kاͫ׻>9#a`t8q+,}r1JO~'> %ŸdWS_໧odt}m%*[VdS؟Bk *ѭQ t~~Z!DQ<ʩ(xY5q{n<6/W#msDJ\oET!źSm{UtUя::U?8RK>L?O3J4_ 9kLL FW(gCrk8Y55N]~fK_/זsN=Wm{]h|S&_Vr׽N#?Ui>G_?qUXX[s=sۿj~Q'yaJw_?Ac8?<ݶ~^]񘶍={wJY(o 36݇Q&=m694N>UtH7@A;IQ_Na}N0C>HgmBx bTb[y *.l7DEr/9r'6/ىN.% +'E$&dDQI:-n*ƾPfM}gr2Ŭ\ϒ RʍUG-Hem󥪮zcE$kZ5ӭ|/t.=T>\DtmuͿUgFwkӮRv1W1O=/Ƀbu6{P\]FcJ)w0>&;>Y &+]QXw.wq۟r? rtxZTEos-'V(2o/~Ox3v8^y*IL>+㯡xυ~.r٫s*%g!X#c ; ēϚɃㇿn˰9@Cq"UYsWg¬|Mϲl=\;H-H hz+/<1.#EFbDy < ˂$*$<>ĨTgLw ɋ͐8(BBBH8ۂ&ى((ʋ੯“d9ęDK HD."ﯼ?y|f'̷ч-i$̘20`Qbg#*EmGmm$:o̺?wp5ב>3i$K2,p#G!T=6oZ&6nX!WK pb8rK(/ U#w!E:sͱ#pHsNaL*#!#KiMp2+,0[nR=a^6q~$j U`'jRe.:"!.&42ӓ{gdWy55Rm&5 -*Cq(q wUree| (SbX,՗5at&l IPE|5}r' fَysFͲ.Y5Kiw3fWoe5SHZumw%m=c_{Pn=KwOQQ_Ӧʛ'ymZ>L=;Q9ۉ|rx,w"eym~DvLkq+5HbP|c[sW[l(l55Ӊ+dK@U19ߓq1{V%{"N' ǘ#&y=Lש==ةȣ ѷfAteXOX>km\ERE!Bwg*|ʹ8SFq3,ye=al PDEmHPvӇ]4^ o'(@VM%]OQB]~=Ϗl-ngsNv.0nCJ2&'.l%=pN4Qq&I ']t+Հ컨lf.ŝƘt%By aʰrɋCduqN8HNJDn8qq8'ʇ`|89LTpt'%"UUM;l vW^'ub6ۓ{@|DAE-dՒnR&w%8=| am|bH92cQWQLn2$네Jj;8=M#~F8qG2l)5LYqlumXaAVAO~ٯ|<gu5ra0I1w E͔ʞm~"MIx!0If܌?-ȱy=J%d+xJy{8Q&jKm\0yoLϭ:?Y(H/rG$穯MX-E(XTT>ѨW $_4O'EEMkKF 1"j"':"*ߺA "*~Ӧ "*~ӭgIDUQv^_g<<ᐠln}_J}zpSv_ֹ}׺0dm.ҾJQH]RDwUX <@(Ғ'Bq|Y8ȀPob~C ̗_5_fdv]K}ېhJn=^>j^l /H'4(7C(O+tk徑䤡Zp|Qwi]§w9B,؉0aT,FPDvSJEm\#\G|o]Xߪ41iɌ=kn''I4kXD#TՐ[m! nJ.kJ ``Wcv0\2O^=XTM<>*r j >uvs%Xˑ>|N:c"\ɒ%K!72#3%"UUUʌٳ,K&}/͝:kʙ6dM2|~L/FJfjDDEEDEEdD5mmllng\Okook2E%ϱ-ǥΟ:[:d*рqwʹUn؎Ac_Ul VX}PeME]83䜒!y~OfDi1Sө՘jH}-2d"l}iFd)&O5ߊxy9N2Kϯ0Y2%K(ucWAgw$y[W0RK(>w8ruxj5 mirnA6=](طQUKIq=z<)*=jϧt٢2aUEM]q*]+(nA~-u?=5!v=60q|B1x6/L䊎%h/8{(`DF):]3::>th1^]T8ǐ&rfa4@kg,+&ӐÝ+k#ɏ)z3ͼuHHI>Mr8';tgq:qaysM{e~ q+M[ifb8Gp]0ĔUUDPUUtTTEEIEPTHUHUQEQwEEOT]gR$@B`D$*BB &$*>PZ Y'۝+ML7Gl?f5pϿ%qg$}]27_wN|,mǔ8#G,L&8ᔉטܯN4}57Iw}P0e\q% =_UE6MOOb6{{] VH#|ĝlAym6:. \o]p|o'FHO.Ȫy\pfYN%Psz׆$48R>Vzߐ6;&HslkD0i׷S=0qщ$tNyE !l}M~2dv}^4Mn)MDo(2_Kwg|:h"xŒIB-I=.L#ZjXt``uQsoy!vGlœ3]K.6kr9QaVdpj ' yz#uгkҘ2cD ӳF}jOt٦C [EkwTTj;L|?v5ɾAԚ/lǧyOr/[P7U'}?9sE3}|O)]t?Hw}j[up"x⪞Z_,cup?Kn"υ| WqUi&cyt=۪C"^$+5؟9|N ^OemiD_EO%N*3)' "m(/ۯ@6 QIDwET6MQDq0ENqmAD_MeBtD M7E2DqtHDaQ7 UM#!AlE\$ۤW |tS٫۪xm'{of-b[{}٧OFMԋͶ{TiDtRUWG/Xtw#hYW\Ʋ/ ᯂ'xi{[b)m_B&t-=c Љy5u!S]E=Ybk2/" iNƾg&ed?V_~gݱd73_O_[oһ8(,)՜g!︩loHw::-]mB;u&y7^E?P08>OoroX~ ~ G=ߠr#\jIle2?>_[?O_l+\zahF<HG2?k+_kS?̽/*ϐ3#=f .l+\zakm~'K9>5Nȸ؍d4iܸr3vQcFJirWrLvveViԹ)qax#D%TETH7.SoҢ^='g}w= "MaOGi1Km&aBrSLhH*HBstQTDDO{Qå|uxD:H)6P/*>&8Bk )m)ճh*ԛ߷}i[wݜpŦa.Rs:4XWڴӭH,{I"WA 1 . Fwznxr^Z1,7嫇uHi[}hإQW\&cO1C$ kn yk_5ߘv7ˑُ_{Yԩ8g3r;ye5'zd ! d=yW"eWq}e=Ϭ3) `(@-؈|}nKdycwaWV]Mv@mAm@@DQ|D@PDSdDD7H9<ʹ??eYUksk0]!AmlEYhA4@:X9eu+GoW2FE t{9fAldL"kN(kL@ī*Qǃ_ JyDUz@ vE_$D *DH"*Di7rBp s\$+SX9僢D*Zl%CMt")j$PjS^P.[$EY E m_]^yu׬| dn23 j*TP|u׼oIE;y|K9/,EMBU`뵯%ZypuR9nn-G2qIIl8ʥ( *r*Wm )Bѯ|yQKn~^:+lzd[`$"RJgn+(C_*N7$[ M\~Ά~ !޳=~")%{nEoF&*:(xxu/_lP=DvNʶ+"UB2/XU@,c2Sf$FU=nuɤ?U~M}fkJ]n r-||ΕK.nUUMԇӶTÜ[ݗf;5B9&LuWev=U<5z*/"0g*R) HDO/u\$wiv/ms'a*cEO1MOj-/Iy*"}=^rC+j**yO^;Pp<\5OI MU!1HӍO8Z(nu{-^KIx_9)ŷp'!f[Ʈy)" n6E:dzCw}nBrSd]`UNMUǻqc6[ٶ[N4ۣ+'G-1*m֞`ܶ݉}AVNw}|^vD]"C<8nΚdD"yoMB"Ii8d- IQ?|S.(~-Ro?r/N95zaSe%)n-ӬJFw'u*nܩ}PWubs oƩ$h*mNI~_]o߹Ϳ'k_\ҝ=-Ccgt%Yv_#0nHK`D"*F|z:I^Bc>O˒_xpzCތvMR_U"nJ+wx'Awd?};U:wE~tbL? 39dk>?~b?%&S2HcIY'ןQ.l+\zahEHOr9Oo ˣ[;5޳9Z?~b?%&S2$\kCf_WDŻ{|ͨ*yl[ʨ x-cuQI5ߕy|k`cTnX[W5q2[9sa1M]I|Z`UwQUI]9 pe1&QCRx'j3.Ć۲T4S%7]}~/"um⊉`nI *"ox{ X8//Jy*'wn%?uOGxn.biS1 F#.yFuΗ-P,'Gpp2^탄61|ɲeKNdـGtMhb*f+f?G|WO?nګpx݊mr~fO4wKj|  vq6i[_R͓"l˙-eK)$I&C$>>fJD2dLo*\*TMd>dϾN<*m7iӦ͙ee2Uϝ!sgMȕ2deI}72#3%UUU'eRn][LĔAPSu#!O2%ADkiӀq!rS]v r>inF5X \%|% 9RE]AAO5-rWjp#9/'p$aAqY7GC=,kǒ//OF訒!vS/r%@2kykTHP~jj A7

((| IQKA)~c/}6/n͵DK7k .$қuuo⫾?JӬD(;l}}U]b4Do׍a׍4hYy{=gm\mW~ S^Qd.9Qu QQTGSMSOҪ|;ٟtC8~5{44,,"[,lVuݏÃ2k_jK׎8ʛLg.;P a`nl=uƛ%Us"#m4y&P!*9//+Qư}^Z:;Iunj*Ƚs0s9C9OmZLmZSD <[*$]0r3y?hV)Jjs'jmsUo>ű+"~l拪ݟw]\yˊ&o-q##G(@TnA.Ɗ) j櫖]5OXsS]MfNɎŭ%Q@CpQWrM(1,v-^d 9As1mKv-ty/o({"*8 O`x~S[Ƃ圚G,ֲhX?$MAjT['HQq]Q^_ȇ4ڇ?+:w"j~KLekצ3_R'wmNw0tǹǯ QQKGibM?JK~sԎme[^>ڒR|5lc7e:qzM6Kv]yTTEOŠ"IJBZ1aadT4N3XQ랗X8sLD]f7A{X_m*riHD랗XLn_04U~1TZݡw7www%blo1Zn2rd<q&d8c:z?w&/?.iQizU{p2D{fSu#Nks?O߆k~+~+]z2ߥvrcn__+dw?Q| vœz}}=~mJ홨$uz ?@sg곯Va؇reK;$'a3QZQ1j0uȭŊrhPUQ_C?#K+NqzfCNk rSmV둂4b|#D%TETR}-^eIj(fڒ HE S}?+w{ϰ\e f~Bj '%4Î6nz?weƎwRܫ]P_m7Efs۾w?9ƿWhѣ_D$*BBB$**xIEPTHUHUQEQwEEOT]$@B`D*BB &$*[/t}qsc`3sr/y*N1ģŌ1S=зܦ "&_ğqy+2*I,bfʺm}r1/GwG]߯4hwΧJ8U7tLt+VJ2:" R- p/4SX9Pv^dX}#voI2E#dM6oq15&j#Eo=` *N D k"kt[ϟWˑ13ܛva\-Sҽ1)b2Ƣ/:h9"J4ɍs'QNSF6篘y'ټn3Xb['.ƿ(+UI%Pkgቲ * ZiQdNL9#!J%TՇ tn}*3QWdG"8nSjRn{wKY&! Pi\ <~M6ޫ4t՚!N5huF4hѣF4hѣF4hѯw2.8t5@<ֿ"B[i[5Mʥ*Q3m!#+=^ӸآR֋msE~L9,U7V&A$Bd{yAK cZ+IzdBui/>Ȏmed4;[:+ǡg̉Tq+j,뀚zՁ^ջze?fIXlme!VctHE(wHim( Ӈ ]Yʪ7͜&|1_ARo [d2qRm EΛ4urgJ뀀fTE$MUVȻ:ƒ~Iw#{oZ؆0l)l!γkYJsԕ:|pdaٶYlAmSK&{J-~CㆻEEE_kyC>D̹cLӐ.Yܿϵu\yA@f,VљŌl`c&i}WU^J4;W6kDk뙑6lUlE]Eֆ?U-Imd7FMtk{9fCt_-Ul vE_$8Ѥ}#*KxϺk ؑ.H|; (p["ͳ,pVئ'McwB.Qt4ٗH.QIk]GVW٬n9Qld@w(R^i_QwqRŨ:Ԓʾuyt(6/s"R^ۀd^Z~ƹtmdAl]\;sITz\8 :Uou_OfQ0e膨3p'2v\wqF/ D$sa* KA!qQ),+p^J.`-ONjuR5a$Mk5pWH{R*iqEq+56|=A<x/P&h p}=6_q0R@-eN2/LV˕]E44THQ~u }{\[,yC7l#`TG*SG?- 1yI^XኹC}@|E˕휟ȸ]/`$HfX]SlGOg!S͐ͯU3Er+;lxspgN.:("L:J.l׊}s`G.{]1> r˒b,96R)ʮ* Rdw]ﯨp 8xo>C ,ϭX_3Tß_aFF?ŋ_C!Ucvx?wG`_j_zlƬ4hѣF4hѣ_ƟdS¿O,sV?is? qwk5='KYlovvEkY/;GO\W LGkʊzq#dp _u|Ac?az3ތM%0!_T5VZϐt:9}$].dB/ڔqšGq(8}{qYwM;%?_VTʃ+fu: lv!TE_3?;F]g#>M2;t=?Ug6w}̍.ڳ&z>=/gGhlVu0t!iS[24#jG|e8|o9YOڃjimYSIkԨSfLwB1EQ|_a.Z:^xuMZ`h+S_ҋA{Gɩm;.bʖeE{9Ӣc̈ +HJZ~kZ΃iڭoVrfkHN*8Ŗ Zz\wYFcLwtvQ 6^c6lx[xB˪y5s3?lT N&EG'ZH@rufUVYh\ b*`/4&?,nxM/2r68ŧ3gTދoƜsv;b:f 9//WQIbDo]|jR p2p܉`0СTqLZ}u1ȴ\m@_&;$~jQnuTsvTzX+#-ʺjz8n(a?u dҵ5 A+髤HDB1`=ƅwD75#! *o;\<Ӊ3YiUp' "oyֈMCRTEv&oeUSȽeFareȮZ[nSFf{l"/|Y$ՆQ㮭UȮ1XnK&fd{lK+'~iΑV7v"'ЊKykԔrnޚܢF.ϼ CviclḣH*"=2L1]Flܢe5U$i҉5r,6^_mP"BZ๗8~}EKEY.2Nim4nF/SO6`D*rcDlǔѲ hI$'*!Qɜ%q/`Yg%QcאTө :ly ǒ BJdw}6Uc&=ecVcoŕQSIt7xVIQ_XE*(/aK`y1!!TTT2y1}&ilPētT#eQFAq ɱjꤷ2ҮI6p I5Ui X9{EyZ:_ 1QĦA=6K]W7)`c|[B;e)qD#WP86>2ْ'Cbx84΅$H [VNWUX]LI_3c3fVUpyByƒEϫ`Piϣ-kc-tSWRկO矮kQ_i?_T5aE¿CpZr-t'e>=X4hz^Ym|b0]1liz]<pNńK;$$c+w49V,hʳ-0دP_;2YN,{yWrðϒYhOPElb&O^_}|jkhѣFy] \tF2k e E2U-AgBRcx^K{yIpk BzA b}A\]tZ%=*WĒ ?߇α+.wg'}}x|;7YeR H\.!{*'%F4O*ʉ)XCb*<ѡ "쨻.4cGŖRcHd_b/4ઉf* $&"`H@b$+n$ t;8P쫥16,yfFp^.Aң * ;~/^ Ir??mjwvf,ʵ[O=Gdeis۾w?9ƿDu/}PNB>UzpG=HQ?:>Y5-\L-4hѣF4h ?ߍ3g3k;rơr:"+m=G9̾=QU]|iӍ`ٶi~S}xc׿|oq%|/|+N+òUl%CW,~ oog=>Lߥvُd&W|;tt{aif v+{}|?r_/z>ON O=oHɿf~UhZ{6ޫ::?k)-?\g#FM34%-%MА%/=?U~!iS[259o_q3Z{6ޫ::h p;3 O&񃰙hm(5yaO1[}M]A䦘q&АTm_Cu ᫆;2KÃZmu;MtRE!iqۏ;zfɾ? mϝϜxvڱw:]4.?=Ŏ7F VSEyߛ<Zhok8NtIqog\Od$_/~e_[N=FSݍK2ی['ޔӨJIݔ^ZRYw_>ZԽa"=e1f޾*# um9UҶy_Rp/<3\sHUޒYVԃZtUCux7OU>āQXygD}&Q~TMO|r=JC%׺6`xu]THDTOo~js1C <3N~f^\픔19$ "gq%OaU!4ڻbk_JѣF4hѣF4hѣF|k|߾arMoatl/^;I5g:\ӗKBbRi[)Ħc||һ˄8ؚn<(2 >D*^y_dչX$kYNqJjqъ}|Eb cʔU:MH2G?u%E?ǧ|>k]j1~8k%:REH#*32)%Nr↹c_9ZvA/t?)J8RcsY1C''OHI]~H!ýϻ=f]tqI9DqU-#CM.(+Fq;;q+'\*82j41$ۨRLe_"MuxQmy.SbtU&F LeZPP~$'i wkNPw,(2<!2Б1sc:M7ls!Եȟ-ΎFIu747=cm6$n8;m:[hƢ nDY9J~RpH9DUVhM~r\j3dUulvyL3!ގ <hTu΢Q$Q!UEBEQQ|QQuDTUDDTHIUeEEEE{J(($+ ʋ㶾9#~^9, JΩ^lmQ1IrP}f?qUoJaX뮥NME Ln;D)*ɠM}^mE1]2^5c[8ҩz2㒧@[.~$BMR{/GXgp/rp2ζ{ ʃa_:-+fAq["mUQQtȳ|bYTI0Spe@| Sӊ(h<1,*0xLZF*詭'YyAy%M]l7TmQ=Iy  ]UjbNauTMS4c>>,G,ڟ03:'}Ht;fHq,zh2"Im:\O >ߓ3!5mθVUU 'dX I'*lifcW-S]}-E 1]֏ox I<R s.vE>xҋ!Y'rEebG Xz"2i:]l_m?-F9Kbg08"bTڮ!#frdȖH%"rizFۑϰ.({%3n~=̘c wSjo2e%I""' _H[6zq61|ZyG6(2"w<UU_/b?2 #O/1c,U6ҥ;0VK:F/m Ldݩ/A&kz5؍|te~y|?k}_p5'}V|iq"f]İ,)bQ~ů.9X7eArbSFM!8*"βnXc^YfIzu9qo ErM|9 fCfbo`+ Mؚ9+ @BHy쩩X_8Ñ3ZӜkaY.I[ɖ#Jz"9p"G@6!U_C9Ӽ{dioVr?#/[q3OhlVu0t!iS[24#jG|e8|o9YsgyOo9o;tkOqg___#g$.qjldېUOwpfGǍ#u@O]_R_'l~*³#쿕GujbH =\P^ض]VׄHԨwi\&!]Jk;.]y+aio%)>F1iWbKgղ>]v]J88{Ea/?<V~;ү/!OG֛}|.oT_K)ıɈ9rs0ZyLv%diO4"YS1b#c۬#W!HlPPQWrMNj*aQ#H74Q57SNKs'L?)mArMV%dQY~4WOd*c-(ظ (O3?;F.ڳ&z8|Ho9Y1 !>źW!5%bs ;Guz\]Lj+֖O[|=tHoј.umznoҒdہ*3)qõ.;,@RtnIӬEp~TvmW-"վʊhnJ*@ MwOR/͸W>pJ9av->:LǙ+7."78IBde0.6m'q8aby-tmɔȪh&J;">& 8H]f5IAr-"~Y4ɧb$OtWRE'zdDԈB}Tnл~67ڭLv~9_2]WXNNƲzp1V=A u7`ެ7^8!s#/|||=mA1L""g5ZOIo:7s2ϵ>3ಘZ241gv?=k*9wu=7eEuS<\B"Wj0Q Azyh/•,}enm9³:ۮr'wG:*! 6[&E<ϹOpeܟ^݋ato-\ai %&dj,`^\u>at}Uz _s)coK/=? 5{?ڛJS'>=?o7R;3[uz?yzON׷]ey>l?po?}^O|sϐx-? ȰLœl1MUM)b*LIe\!!T]Q,s.0E/p̦&5+g6m)&&d46d*ƶ¢[lȃ1$y-N".&Hmۉ&I⊩Lr gw؛n ***kQiu6llmT 01T 0$ET֕V_e[ae[ /4bN *"Cin82!VDma78tr|&nc,Ŋ7 QY5MJ>?/?Ɇ3TYF_Tß4n\.uk{F5ׯs`W# 4N= pm:.m$ćjWݶ/uUS)^ׅ®g\/#lQ}K2yAھh{e*K\7ŕ: ߈WBRwą:V|?1{bﶛkqC|Yȍz_&3I1̂S`^ kW;_ѣF5}}Y?'| 7hWnTkN\3|1?%ur\!̾?ջ=VF/y4svo$JgX"5>|qL>T rMٯ5\ǔq|tx^ܙIk_EtfCECpT>0y>l5J6%;HtFqSmrcϟ%=9w bK~˗Z'KVsPqUlf,5EuthѣJt6XFAM)7Vp.j;ʲSS`iWtG#`L~ҍE ]LiMc ֶ[^Er[í '֚Gy :y}bBs!IJm3uWذŕdUwDv,c|W|KƜJ.-DmRHÑRôr *?$ˀ^8 x3U>亅o 2Ͷob؜2N&\Q|Qu:{mYұ`"~jHdP_jj]*⊚ݽ'p<Ü厫_r<Ha[W;Zȫ0D%"JԁL:4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѫ-2Վ_V?{.>G\ 9y|YǯG_Z=]~K@_M%jj+c+_Me]mk.4hѣF4hѣFbf/T:M#sF'/t_^'Ҝ!/1?M)ڸݸ'4շHwIo<4Uя:zU?8RK>L?O3J4_ 9kLL FW(gCrk8O˘uw/_-k-f;?G?sÛyP}ѣF4k{>p1q&$ç cnWvmb?6S`L_Lsw7f?x?sT151WyG5_}_n4`N6Nn6bm&*{fӠn6f*&&*B$*$*.C6n2`/Nۭ*ۀh`bߝ{>ۆq$#pq'!&OdQB.ʣ]X߄r1%nߕm뭂ˇ ^X\c vU*6=Xa^Wm<ּHG,K2<";Pͷ`O!+[*F~_)쓖[g䣕U:ɞ[" ^C 10,rrVYAȓXCidGx\>ƙ8<. yO<.F_rxyǽ!&0ӌr49\gؕtI![CSSX۟SkM.4J$*̸"m*ۂ*O /$ʸ/5qQ; 8ynŸ\e$|cUgbM9l7a61_ˏ*O @h9[&az Rv9.Y02e1ЋoVV<02E/) tlƾHEr^DXk^?^֩,=Z^^ͳ;'"rC ?KQJev"lJOn1'*خYGP>w=LnO|n8אjx۷DrUscy9b[}4Svz3 .++G/n:jUy ?ͶIff]u%SO ef[Gu UET#ȹ>b Wvekr9Q贌e_(M*.Zow|Mŝuqaw nu7d'UrݝtGQ~+ڃ@g[>žJlJl|܋2CD+$*KOc>#,ʮ)jL)Пr4-Hh|PS][e椲Ԇ}eiCm$ 0$T_j.ݭU%)5UZLhʾC'Bɢ2bd1_!T]}scHronvӁˮ Xm=.vuWnҠ2";&iۇ$vk4<n8 ɋ2ЌˊWՖ>M*-Hb*HNsoAk3J\;J *-Q좯UE }UP~`pyW~/{{֌V.Ϸxg!T? Tє017~AqmE9r?-ϟ=zOSmOs[[֜9D?~ec5Г+u4?SZo}sZOy7Z~"jךT_շ/Tvx?A_R**7J&wTO˭x}1#.dĊ˒eʐ14v@}wYeR"%AEU]cDaRn4h8 1A\yqQiR"%DMYZ]WdW} pkIa.<0c=2lo7$8'ʕ%cƎ "k3;[9i/;ιzXocλ_\;aΒ=)o'{yw<\l6α=@v\AYd\KoI F:_ 5UO=Dyoy|r>+gH ?boUj;q_mlJoc>AjǏ"d"DaR8R >{Mu宴MrGSѠȊ8DeU[&]Adwږ3o]0a1TDmƙK(2vGE&,UhU*lJ! Wo߆/%]sw_lODlr"%^ J  Vl'UY~d5e6Lɇ:\I !w 1_$T]|VO6t(±&R[&D *,~;*j[BD!TQ$BO%EMST㷨*mEdN<:.ßdwbT9Ln"(/jK͒},%a]I>8N2BD9-e (ce;3Y< 0Jv5L,+@xYm?&q(rA} yl\}v.QC+(. vܕ&7NڛmW{;ǚ~)@Fveqrb9KIWezA%Eh ?_qOy~$DgW~k_qaC4ͰdԲTEv2J#lD8m3܅d.OB(ND9։PsmU^U~ð!8|w`!qgRUC]JvE׷=rU#Vo)l㫵Yqf|jt,N;8*.N}Iv($8 ("JU͗nWo'ϹK:bd\y9$Lo1~QZooYB ֯I!v3Q|Km!/~HkNْ{||SDJ;k?cw8~]I]c9t;hKԈفx/ ""?*1ʆ`_cXҶi,8$&+$>&&P~ *{WL9G ɸ1|̩F/BfƞŒbd m֝lEM D>,;bGi}d8;0_v2?!0E7eO*4k_퇝/p-sd2<$}qm+$1 ~{CuUU$OXSRd&8Ku&ʾ:e6.|;+"pŃK~Ny.[A:AuÓY aF5K5Qhk+{Ví'|~qνƙ:.\r42]c!ʊ.TIβ9ZjMpe{MΩRP3-8츎.J]đvSqE'QSSmSo_$ -9C|!׽K \6q9$1ޑ`5$HTP~%  D/nھcLu+<ȴIQe][/_쫿9կ|Ni%|W{@MKRTO.e_fw>T%D|٤P' HMԽ-tO'_5Mv3_6S]9u }7_\BD{" PHE_K"B"wOfI1I/tbDQ||l/R"䤾#u=Rk ;}(l~n⪾~_/he/Oɭ?m?.tiu>7!xQWMAcz>HX~%_cܘW׏&Ѧ4hѣF4hѣ[IvNOjGRpOk3&n*J_gסvW/<ݖkK eEE ,}|_$6#-SR9Ǻ SV8LTRZGr{@Qd'#1u@ӶHp_sg dSW ɐ.Ì8Dx]"f:@҆3(}jè]sT[n~Tpg՗ѱ#b5Κ/i8krm Zf]F>/82vObemF!6J }v}y5*v}W9n,nM.4; iD>( vڿnsEܯ?b򀳲N>,ɘb)Zm\a|H!d<0T""YeQ:IQ7F+= [!^OMwofQQvGڿ^Ns܏9"5-Bz+< ,}nW]ԾhiMRg0h/iyAWA$;P.*$v;6{QU ]"RTMOh~t{3i8&kY" $4ONO$A#)*B_ b&. "*")3b‡c ,ye2xPM\BMeM1UQ|e)aQk_}SYyQ('TB23S!Jl]pBDgPu_s7R,N濛_4pֹ۪ q_xK_kK>4W_l}k12%K*J2_1K@kmwӞSa])*'R{G]NrmSuSDT/S֛7EG]\7UW~~tOjY5c܃KQ&:`Ym֠ mq.Q| h`HDq]|tɧ`E]<zl01m8G!epT2b==C+b.Nu wݲK+ʵ\>q[%5Cs 5DU$ThZ9ˋ9sKwBiHD$*"E&Z֣`?0WtDI[Oox3F_x9NNXs\Iw hFw 8 С*Qߘ>-}6|yInØjd98N[UR0 f'Ա[눨.OEE^A,-rWqI2I?(̩qG Xz6*'IEE^AmRuQȨ֨ݒ"/OhrSm 4Oa/i$"O1գ=)_Zdmuo"/~i{_徰nb{'xNbBTMwe/j}|.+ꅑjCÈLfZ ) oZmW}@:aQUW?3"{S߃Moq]կfCgmښJ6 <SoI_wS?ׅ֫- *o**J}F&w>Xu/U=OɡjicJd<^'>c uE&tuP~b_}w~?O8!|QNH^pr3GZJ;*ՎMm'_i]~~]}yt'_H ڟBzՖb@'I/SZ4lwOOj~~*tx}/?{?O˯εo/~: :ˬ.n(U_YYB]WS_DHzr컽 lA$UUX(h ,Jk>'@ 3$VlUw {^ECi7mgdtA&b *^ W/BSw0Z̚$L3~,L"QnYziɳbQ-QLkPua ո-!.).g +nڒhR"PR͎ ']7Us۾!ݴqS-49] 5{wx>܂B~5M<н2<3/x~kob+ɰ^TIoekb7d]Cqbl6YaMqd sl5B2v_)E|z.t+UuUZDa[e_21G|Bi08$H@SmMy0llb6RV%BH;TI,$$\ʩ#Yx**/]ɩqܖmE |KjkDԈ6mm(q1yp6St++ʓ%mC#y "2R'|w M64^o|?o_;Ee_ad~ T^JSx 593ܤ~dpb0nICj-&[IYcqc!vb lXE78Oj@tNB{z~6uWsߏ[L]5O.K_O絙^+)#]]K"&OJ u?[]k~} tz/ֿW]G>ӸM|7-}k:XQQ?W]rֿNJ}?S}p28Dƾ`5}}#sટsӮ|{@DTU4--yxӭhJܞPoó{S_cܖ*_y }&Feǝ$RQO%ׯ*'S=IO:@hI* yx'`TQSǥWo5梾{'ʞtnt ([hojzDN6~/Jªࣶ߷n5Y!# 76w_np<pNیFJ';. ?^E-6&q>DjߝQ]:Wdm8?|?^.7F[?bek]fT_kOe?&ޯ u[O L69heE7\<\nߥLfAtvK<Rs&#IV,)7|@O/{t5m &ۣ+ZOJ?GК׌_|A]}*s .;s%3Ǒ  5AT{dPhZvM;NN8ΉL[hA}_j}cM-N~dkQEtX!LY4ԈlLw~;" **.Jb$!Ma0Yq%2#J!itM}Q0$Q!UEEEl.gAi ee851dApBǗdIba1 0%EEETƯ?౼ 8739+xkmƫK&dѨu)wyDߛk8/n|cU y[՘SKb<5rGydAmGǢ=(hm*.˶uݚwc#CYqdLPf4հ>)h͵tAb$Y Fm[65=|k }F4u25k  2ͷD-ORY )}Lgǝ# Doq6˧GQH*}'؎nS(];dnc=3yTۄ29"ٴ6,˝j ]W>2յjճ?C _֜}|=M3}w '$1UiD\r/L)U_շOU? ?vﯮ}`{_D<[5X?QeOM]}O,zL6Yk\'Ӡ=_T魗bcR]eTS].GQ_yS):z6]gT7Ӡ=_Tˏ9[A~ppEEG70Hb\+d*68iTe8P6f^C[(}7Hv6%O%]|x"Q\'4J.e<&ټ?.ܩ[O<1Eo4"V ڣ mػ5;`;0 K1vסbyV4Zuqi-"Ǒ"V\ڣ"6jG<5FuFmGCED.͵ kqb%q2pF\~MoKKȒ#c<9bf mIi2s/$Z~#I1?ulWu Q:~~D>爹>p,AβH܅QgHY+ "KQӭ!KJ^\ǪR)qQ_!dx2_5v]3L2ƾ_'`p#W8oqޛnM 7NVk\r&}5dթuraSKܘr6}*ml-(aHSm]-jU}ta΅%nDYLf+BGZq\e&ii6 qP0$*.Gb '̣q{Lw!iXm\ fe|4/*k_#^ˋ{!ϕdƁ8i8貹9N!C,"t7wo϶|5w5Ź# (GѸ z--QL"IDפEd+ *=[K{c*'P}$])f.\c`S *0%ZW8DK|Qf +ʨP]8BUv6g'}G_=>/J|_ҽ|iulzO_`i̿ԯ5=>C j,WMU?eZäL!q̃,K\amV2KuوquDFC{[^dR->;Oe{m)vT[Q u̼٘Xdj$w>] FecL8JcQXU̳![(k%\[L$"')rFwgu9Oک8?'u(@Tzj """lLϑېn8r,L&VRKnQE<5Ϋ9Xϲ}U^&kI)+{͜|Ǔ*&gȷd%gXS[Cl~ĀPDEQQ-#G|0\+d2Z8Gfɂ[~ 4XFى6@4"դwqEe2CS\4}b"J?/T^2J,>~k͞4(:SkZ0}c"*ʿrvhX"==Ɖ5:wի=s _>`U"ܽQH\=&˨,܂=.!4BQ_}jѣF4hѣF4hѣF'y{[NJ)YXp*+6YMErDs,cUI^{vܺF+cuf,Ej/ylVFy=|EF08k*6 qkWbFTX >d+!RQW5M>`@쳳w5w8&!zq,XtBv\WrxJHa4=[\"&}ͤVc>[왓7%"%]|3[Y_Z^Mequc6YYIvd\_$Je"Uyd'_}y]]57%*ׯW~C}d/2\"nW./.?emi9a>KkFj{['x烱W$YV qbm2Cipuȁ$HFBBpu/vqӁp6kV]nXګ$T8]ȯ_M*`D !!8Y($ԑW*I3bɐI0[&:ݔvل:Pg.H1rcXeLgLSC 5_%Z3m%JF:/qcʣkXN0j,ȷc[ 62/;D>*#I.,K>~iū'2-DmF`co:!Lȸl2Uţ)p _%:RF IXq9O}Meߏ A&Y$"jI'lφ&wNRğOaf9SqiV 6E! !Fᯡod:m~"CwSz/o[wgɽO_xVO@9"*Gm8< }Iq?㡉!5ׯ][-}kԮ;̩lRW{8 e}HOXSKPί[QOEƞd_ z (GG:O@pzWb0RTs+QOI׬fd^!v8*"&嬔 c- 'ت!BO5oyS{aŝȰ>V\zr&d("MrĈ% [[ Dymqj05qvSqyNbnQq+ƪې(mg>[}MisUiE( 5#m'1;8 Yxk>(w3aqˌx x}+Rɩ KNIj w;Ajcw=qx5O FJeh W[Ȫ"#o(H؊l"vn(\v<~LZaPFp+ok_DGQuP%0.*GH1j캞E]cԢG WJ+f 5![!xﱆ躥?=*ͳl#q 7 9H ZjA vw< #`GُfU%+.m)g=QGp gaN0pwE.{d|k|}*ܟ !ZV5 p~#[.t H60%UO[5j\/E;#tu*n+Bw˜Y(5Ig|e]a)J#6ˮV,nLsCp1UYX+_$6Qǹ=fIYD,L'jf{[u^nÔn2^' `~A]D,GS%7banSZʣodnK^; /-ڨ{DN98훜xxgQffa;Rr"q[ObIp?;_G9 89CqAı•ޱ35 HәdOH@H*wY'`Xg"/8)2 WGeӕdzon "*'B+,#WA]Q"G}9 %lI把/;qsF ,fb:8.85Y],;tO  f"BhN4d|ϮOPCbm:sWU{p2D{ƾXuQsbpg_,:X51)4hѣF4h@e0T}|<:>5Z\#Bxs{n |knwߓI?"jq=L/}܈#O4kfv[F4hѣF4nGǸSF1=įrv%lI da`QUYg漑> h{}s,GngYimo޲yUp˚Ғ)셈6퍎m_Sdi/IaKz3")rS|sxadzk2xMe9Y{äK#em[W E&\r 'Q5,QE|Β.|q{QcPs^Dlo$R~ߋMmEaFp-4wο|gkk?$Ng}a6oŲLђc Ul`>%>PRUHz\{& n12Œcl ^90}Iԇ DTD[" ·'[1 IR=Y0]E(MȦGV]y7Ÿ%ܖcܡAIO33l}KLY RΤAU0Wf>~O7G}oSՆ  ꓍iˆφ'D_._˗О?ٗ`@cthѣ_"r=˜Wq?Քq1苕=e7Wj% $vEo=$@*SF;EV)/<*U7+"ݺyE2\1T~;+7u=Kw_; ut/)PDw%>kzuﮭ{UG(.͉ v.Oax\{e&îϫ'U2FjѤ_MkŲk,̯Ve䍐9#r\M]W'͊$dW#hMSqt8hs(joE]S]v>l}|y-1@حmYJ}F|D~_;W)8iBcRkz5Í}|y.3eV?I<ޒ$HtM}% * }|9QydKYvXMu}$I1jTE]qXU>$*Z: h[|{nL+ cn^+7fJlzf]@Y)oT%_w2_&R??tUkO c7<fUݿ }?$//}m{SN㍖CA]Tʨd\bKjH_ATf\b$_M wETWqUEjkڟ9Mk|_/}ãێg8|-:Y>;-Uyr;ge_p)e#Y'巘6M9B cI~NGt <_ WG-w&OqY ^P86LȎ~FˢIຠvim'M~#"jo⭺(+EsUg/\$/ n,8-[zMV 'b٦HRپ[uǜeK62 yYqZhTI Q^(b~MoXJ8G-:Säa!%ChqLVDv]c6n+!͖}I}0H{08bAID6]vReN9ܿ q#yrn9XJi$V_>;Ǣ~(E-}k4hѣF4hѣFc]v}\)_MB}8 ]e&4D,""!|%k+Ts_̓W,8%1xsV)aT2<)m|5Se2={0 P}vu F>1:˭bURb\IMzY HHl>(H 8,$\Phઊ&LM]b(J^=:W_00"Ѹ$s}!:@"{H? wOU$v8IvX R1 _p*Ȕ?MU5FC@m+FJJDJ4O\w GǧdMOWYU'QgƑ~މhH~/;C%SE,UEʯ[ƹV(IʙMzL7[v_øud&HH -SfJGB}+U~$cqb\q;ۇش3 H{xx)|4dFaVD zA~ .C|k:O=*}7vm1כUï cYf=^&鎒nяߙdͦѿ]ɘ.<.#ͼ.GFf{uSjIPH;77X릪VK~uR4_qTD||~Lfu3܇hדߐ+*8+EYz8#CÛ= kv(Ȟ'&Mb8A_IHtx%Cs0UK+%l8Kxi#!/2k *F lX^i2d5;.#2쇍1@pUo1(,C*ry_axY-`㵒-Ɓ ]{۔#?3'mTTMH * =5DQE6M| &igm7DGoe[dhjr+ivCe"Um,g>XL5Ix$~N_>cq̋y3[qt3Ȭr)6 b@(""((đ~qk Qr2GVN#d,#lěudtj|Z#ЛOQsvԆKHmv1f*۫!];Ҥnsz60̵} :Ӯh 8*8" /V຿?&G̿l*ڱ\k|<Ubq5"Eoy5=\e-p=s'n^g@'95ROCum "v8y[MrbE"djn:SETE]72ŦTTJ)uRe=QƐI|uP;wt> qgJN(19h.>[5SFhm$_-na^s5d? "!D)urYKP Gg*/}K%M] 5w}D)-ZKБSe_sZ d} 4`H_,QaD;{mvJ*zan^(?ծZ˓e@nAv!(ߎ5|uJthѣ_2:7%O>_GZC?$Ɵ\:v|U_zNKde|1 lMV>fʺm}r1/GwG]߯4hѣF4h7?Gko<Q;!"d?ugݿ_fN2u=FNevNRS_u]x[Mt O\]Xߗ/݈Ӷ;8n!=EbcI  M^AT:}YqzI<S>Ibٍkv5AT>&dו;4 (*x.%C9blX$T&e0Ԇ6TVEOVs6$c<9,jV?cTU$mZyWxizI B>a_%>ʱ+W 3icmk5s+ r'W`ƺi"40R>I\_kXyCYYqus.1C\1XO26Fd OMe\F2CdIjZUI# 6{+l*f.O]ǜœywϼ%ŒMrM3e(856&=rAqhͧ@q&mP6DLI6T_]|Ϙfmۍ! &ʋ⋪**yS_ δ.8͛/2fӭ:ۍ8(n***"gi]w|׌ܴONۄ dU,bӋ>981*Mع!N]zնr*̅T<(b٬ڷ X#B%/")6:p Z23ȒYE$wܕtEUtA/4M[{Ýa:]6x膻96. ΔCu "صJ _4v;C㳚zZɎBž UA/J\) /j*\cv4yMm5=^xlWLk91$英k3.;;K-Ha.2 㱁"!'88gexn*QOН]1CtE$5[ї#8O!T{UǸo?M|zul̞yZ񧯰~?4M_W??ۉnxsg߿*{s2 D{xtu-MaѣF4hѣFs'qhߌ5?YQ/!Or#0|/|m?d̿S5/ǜRxSυ La_Оca!woξ,W7?cSmOM]M,zH6Yk\) d/{tc_U"-Ǩ9."wU):H6]eL7Ӡ=_T^LHY(#GYmOSi0/ rF?7L7q[!sLz)犁6CC^*y*g g+W-sD<1&~*J@yyxwѤĎo'%wAZn:娷6N1+c8E"3D2)/0qKXSj[+.BA DR .*@*ҽH"''}7Ԗ3@Eq5/Q.KWG"Kȍ_WA|%$peۮRjώ (!q@Y|^K6 c,>ulWu Q:~F|:y%>oE3|s&:#r MWj#f񒧿jxj|Ymo6L]>zI/ӯQ&ߺ-P8ꍷ1cוFpa?%^"ɓy&Hb$H;&T.xl~D!ihTPDQUWmwD"0O,f\&L#>-6*DD"(!#2""T܈vDD]}Y̙$F gM1D3DR@x33$UUDM>.O]wtsu׫HͲGvl Y҇dlNjo{_=sr')?!h[;I> `LNL+2@˔~vmvJyX #U[(* I-)ϙOww.cy_;tO>NG`t3ժ$ADٳd38"TRcƍ7_(D4cÇs%hc4d}ihMןyAR"TDM'@̐ȕDETvDO]Q0f͇[[Ukv\eÇ88R_pAHUQ5˃hȧ5f<6L 2oMcx>[ BH}3wS~#U[rHBJPpe.O,v9$ ݆q` [W:g<I|Ww|[87϶j]sM 6Cϙ̛CeGIULJXl Se7C5 s?+g^AM9`8mol&;e8ۊMƒmJiP}8P×p]l -S=N`1 )ڡGidN=S+MXnǗҨJ<ȝf+-aB4v]due{;ڻRbCQöj8d-AX6'܇dqv:p[%TMܡQDU%^O߀wȓcȣT۹|*sd9OW8påv^Ac͏d9 K-ŕߏ&;틬HDM< ̘YnDi1.26D۬! *.ڿBb&$(BBBBIn*pD| Q@}1&DнTY,"4LL DQQU_ƟdS¿O,V?is? qwk5=uݶM;\7J$=mG'Om:Ine8pS#i c]5gIx7>AwQ@)K}qe]GT?g3IJ.:G*<;^ϫV2~7Xl\wgLʺT6΁6#Ĩs"<"ʌj.3";퉁 "*xÙ.dK_: &BfLIq]Ij.4("fك* &$$Tf–ʾlj,,YnT)@yQ$.6b@bk?dN{`cGc.AqB86eMކ(6+E$)Lꄄqݞnu^VGcݭ(fQX!D+ Efd.;e$I-ꄊ C(j7yfpߣ}Iҟ`M&gx=]#)1 *Gp9E~=]:9nHHEluft'5if(/M/bݢ_![Rq9p薋ZEr؇2`V__uZn4k]Xob[|Bf x{"zdUABĻ(+)wH=-SguDS0Ŷɺ 쫲rۦ5IH$XjJߌczXxj.. Gӏ}DWjl"DEˮsuY5Yjf + 9LcX" ZDV ]*d-"kX,k/n9=s$9E rfr'@r8(V@O;NHW_[H~eH]n>F=V15P2i`p±v.BL)ەCЅ\ h)26&\8ڟW#&Y<-9srh5xje;}1ֲbU( r** Gmn_ [3ϩi`*/ Rdr]J}~)ynqlQի) r!%zH5 0z9* m!au K4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4jq̯,5c<W(Fy}nğˮo_ϑFCo;sWֹnt{W߇R<SIAk k<SYu[ZˣF4hѣF4hѯً"@m?ѭ(GIK%%נIqt~ SJq67n&Iz5mt1r?'h3=M-cN~fޕtsW֖Y[r\@=Wb3^6 l^U!!BtThϜY Im\O*&.  (ʋj#d3 XTKr)6[eosuAH PU<5'mC낿.Od_T~rpp/"|쩿//rw|>vF{ mpo˾'\2fN!+#.Q.JRR'#$S#=tBn>]) NJÙG)drNV@\wܹ 9Ħ\[ F8>93PغSL\s$CB![Y"~>MA`GOFۮmWǷߖT.Zُ2e,&^N\a7@sk*fhW bJHIJj t+}'m_]D^4hѣFG~z99Lo))46ɰ z"J~.QYZ9/'.m$">]wǾ^W.Yyɪ <;J#.z6KuY9+$|\1-+`#bDSw q^>7Vb ȴnn¶-$ɍ+'깔a nl>H|9;Ų^ƹi^n,ݭKYFiX.mK%=:̶hfi1.4ZI;G?+*Fy_vU>C乇9rݫS(r3-ӏs)M9tT!ϰbynǙTYM 6:u]XѣF4k=|{KS9##;,דy=Ĥ9(ihK9(# H&@`ǝ> 2_a>oNV`.JfLY#l§7fǦaq2_8efq>s3ũ0t(&/ nNɔY+-O8)ȜK̻~R9k-߱C* ÔǁEð[[Tf nLRF,vםs˜;&:v؇-sOϗs0\./aUtSTE8 ԌoUמ󢀊}I-vk폲U\_Yĭ0fE\VSW2}T\_ [X]y(R7+|用acرdqóc4L YG"*"mh_.g6ΧaOw)/j(oiRø/1_xSNk4h y{93{K<-YW6^_T8L!..DN"7.]@Kl۸\fۑ 6ò3ū-rkI7q+t -i+҅҈h/WNK[<*ǧ fmM7'5sA/8's5 Cur 7EUT]em5vc[N3&c1D KG~W,n1;ZK+*t9P1*lƾʑcd5%i#CW~j;~/] ?SM+u5_K5pu/֫em|SFnRA/y~=lU\EMBK綞_[0EƫmJJHx/嗤+;n{k#щoązvCz.",~63LeȺgb1^QϠj򩨪9,N yXL\2W 3U]]ᮀUUg.EVS4n:˓lDoGdD1-:WdM}_[A 3-ܤ;ka'l&!dgw^D5gSYnŬ&1D:#YFKQ2"|߇[U;-(lL:SQFKN:F)2/W:Z^_8mϿ2nG%*B%fh8y8׶B;'1g'xt7 ̵KuOtkG2g{L%p`5%(&y.he!#YŲ8jK&AD~{.8[aSȯD"\4#YF6WvA,9u Hq_6F (}z+> wN1j Gq.tnLd , o!su]"]َ؂b6KuDM}S*~4z7WWyk;KRIԺuJm}:^ 슪%?oЉ =.Fq~3:@wXN*Qr r6 t!Q6nxgF[x]|u+ָ?8PY; 嗰I`Є¹RK(bO-*e)(u9߯)g]SܳC"WLqmpi umٕهSxKݮ.[Ua031A,+r}P)4񌟽M'S:+_Vܫd^}Ks*i9J_qKeFXS'[77 5DeE۷.o]یoOso<㷗DpW'>?^b}w9'_sG(ߘWol_ʿu'R/>,W4ˇ9 |dNk?W˴73kYh'֜0{Qi9zETv_~IUo҈ntyGUvԷR^zTqTGt SJ EC*.yd[ Wq<<|4ߎǞoߥ]|nzClIeJ~o=#3ҳiU/ ݼ>ִON J '<>*tW"]M?O'~]q砛vǟļv.xy&mG T=9K]*ӂ TOo}Za>_="qw +_2rk_D Ub$_Sei{ïL~]_c4hѣF4hѨyxy[UG0 >u|dLmGr7gg" `VMzzYtgAc_mR(^>#!<_"W&ny|{9t>ڶL_OHb.TRgMd=.\$ʒ="CΚ J:LvT*T'_&C骛*"""'''ԚJε"d 9Θɗ.S82#3%R"%U]M]q|' qtC͹#~"2YZLd*M̪K2&t>*m_Z-kuMÕ}errf726M5fr&Cͦ;34a EOHv Utut /™Pz4# ({52$@ÑBIqcɌ2: $M,'y.lk X. VŸ"̉!m 1_$TNOwʔq9g.;9.! Ai/n!}OYzQzN/ ~}f !zdCMQ<}!oYzWdۣdlDM~Wu/yvOX=yyr~*x"{xhV:Sn|w&=>opymy/&/g$軒1\'NXemSٯM`}?sכjmSGE!TM?ӎ!=fm}G ~M}G ~M%.~'& qyzPG:ӯd'BmmҧzV~zj~?)uhzu]vSGI'?j+t|:.3V$J>})]V⩲3_Yש6NcOu#e|xJkΡeJ-7^U;0ıeMk<~@*;||w6rz_3 't=ߧ})^I;yx-i|;kӋ!AWp 5}-q)as\׭q3_V,/?g3ǝvQUSxV؝ D SAg#iR+pLT7[﷋~%*+NJk3|f2WOk$ۄ}Sl~ z?l"ZW u "H!.>F78nͨsL,ّNU1Hma d3f6aMG]*KʚqT?\]yǃXJ ͏eקBxx)d\H ^"ɿGK1⻯}zS>9ݟ+n1\cՍ9f AjDaS[4lor_q,Ky;pV*[Z6EV-HK*?Fm"#E$MUپ>l/m0ۮ}1Yz$: Ȏ۶ث2CV.PW]&ț4w܁b+Վ8;YG 6zVGzM>.%1DuC^6 uGb3+ r{)-Rsg}Kں0~46OnTᘵ&-^ԇG cvD76M+}O_O?'}zIMu7b~?)v]O kV.巃(kW}]ԬTO';G''O˯_W ?.~%G'Oˣ'w+nόDŽxN\_=>vpM{Gt+k}קtk|^O{?w |5 _^?^3/5i'ȩXN.M:^\-8#|@OߠYν6:&䕾<7U?7},Zm-eOU?8W_D &'WrZpTRUEE{A]MU>"kEEPNMՄ/ E~HH Oc)"b 숈"oDCٶ?:mKSKoE~E}3{ʬ>J\mڕPBݪ咲v726OMh䉮3iMXi/~*lQS"BY6etğ_*D)ˊ&; /6BITtRfKؓJ~ȯѥtؑ_uDة=4 :ViU:]m @I> ECe4@b(B|yx.T#s3mn+f͎S뻒bѢczz{Npi2\bܓ,tVdez8h͘`I7#Eiw/^q56kqτ퇨J*Da:_ÄӠi475Q:4hѭ9ugf鿙n{?5z=4h]o]w?tr3LǴ_3߇ Q_g_׮|Nrn5t?$kv7?Gsh~_pNӟkL4z__ _aElHˁ[FoGҜiGC2l[0[0 |`8-.k*~Ei\zBwkMnK74OJU#OYEҊD617TEilqb۬~Rz SӓKTVНE*XF$Q'ֺ^F]&k#;Qib)pzrB__. xD"l8:K|eisg4# Oi޾,t7pA?brOsQvO".T!ҕ_ %[zdSоca!wnu/On[X~?k^SQ-r~5c-sĈrN^9j^ˑ j8|s z 'ٺEqƊNV?j^jߕ!eĩDm1 Br::l 6yH*} ꣹~9>ٱ 3QH(qYlB!K}?vTqIEƢɄ&;n"<إ<3,TȲ~, 9 YY#\n=H_I!\b&!ܦfTiB>A+F2s~PUMǩ~jD$j9xM}r]{Y59;aNec*.I9 #2C &ԫXB=|܈&dh~p= +Vl;bȽv!:e9)o]6kME^*OBll4_v%-ŸxS2۲.xZ_&vXLBu&eV4NGኸ, 2j*,O\ 1^I_S t6jbOۃWdWGAc\*;|qK9*ɭ/ȳc:#Wؒoy4Y1qOLQuy'f!oeSxeMFIDӡ&glK܏w6Q|3Lg;(]GceT=hŽGT_xE_7oQ)fʺm}r1/GwG]߯s?]s}Xja^IGXU sk&hծ|9ExU8+6wVl򲮦e U <>-"l^VnYZ@^Z'LWx@k_>{.a)ER%LL/PƵ{;tuk__f%竊וRk 8SXW]ڔ^_N.3ThQİL"KṊ\(ۢh |Wܘn1^*xzWQ|BׯQWٓcɎoǐÆ>ɣ<˭ӭ8(BBx̼gXíM<N(nb$!"BQ!T!!UBE>ݜ~{Ut\ʜKe"-EE [! 'f\uFݯu6MNt'F4hѣF4hѯyQ~&^%:2|x<췛ytfvy%IaT5{}h=Dܣ$4+H2EXFJRJQHF3i۪{yryn`f-p-nVo>vY=ʇk@6gb*ƾgͣF`Yʜc|grw 0(HlmCI}hA("XU$qu֭0nodxВ$L$!QUuiJ אUCq 7,*^:Ë鹻yc2"ɤN8xͩg3 rƅ]FL>OTpPP_.<8X,8#?Sګ-_uWw"D%AE?_a9q"8cUyN\kg A@Ww"NAE*AۯY7dBR>?X(]Yb' ' >-?eʫE{[%kpUl: P\i%L#ao^~s,ÏfX Ĩ,Vš]ؓgX$I0,#rpv$PU;/;ו0`^m˲*|81jlbzΪO.4ȯXӒ,V$Hr)0x_M.Db#z:$]/bqeqgr+7"}V `8 =;eUsj0&V\M/!Wx?XT3l;fHc6"#d.ɱhEUQ> CC:dlT؊""*jSJzK{U~0QS~[ L}r}ϜB#$Vl]V8%muW5tiT'Q}8%̗a>K'NɲoH.S2qH}HȕTUW_ɟ*L2l˕!u2d8O?!MTyMHUUIUW\37 pȌ̕HTWHwU)ma:\ ;9l,gxK:k&\O$p̕HWu6Ip8 pL1ە$&qw1W$=2d tlvdw0p܅QZ*E*2N2X!̈́dTUE3WCKROQ_q%EՎ쿄.;q'+K0O QRBO`_4z ]oe$G<8q؉# F3M4vZeZDDD_x"ac2xѣ @[elEiAADDMбDDE6DDM[hpWċX`A8PhFhY,fD; ͯlhѣF3>zCˍDj=w4=&[,v^t>]%l\AU$}f_'9.wa4yke-@Y%+qĔU+ HqJEO9Ƥ`f#=An+h,D'1<41<~A聨u=gf|Z$ kc_j#U'JY3?Q_\i⟨?H,Ќ)$vwW͒&fo"U ]Dm;KSW/ f1SMעJY})-E>ٯ͇7g4)V/č+y'SqS j7  8xo>ߞ }lOMgI9KUnf_p65o,_7. ŇVSӽ}r?Rדf5e5YF4hѣF 4c&ϯ}ǜORygU?·K|uQOӏջ}p\m!}|N~>U7gM] =oygϿ֛t] ԕhѣF4hѣFY<{+_%y aHպ+G1]!Wk?8Jv};!&ruN*@;2Uuav:(HRMDNdoEīQSi,G6>gڡ;=E zUTmxoW ɿ0KTݽpUT/+ym& NN3}x (D&e:#ѣF4hb|{FdY^YsAAsv5_wc8c5YQbp$(J*^~FM}dG*]ymn|wǫٲz=nMBe` &("J*L,KאFغ8^^"x~b; eusSϕd9}VIam4[7 EU=\g#f6m]J*ZME ÅrFm>]wf5㸌}O%% eQS.Yğ/ѸK %03*|.mafF *GiUQS-oPbmu0̷M~x#l otS ۯcGq eAy#fYmuYAo'lkf DD+jBg{sNu}}Y?'| 7hWnTkN\3|1?%ur\!̾?ջ=VFyrsvʂɁr=4/!O W.*CDA^Du_ }?s"ȅg,Ҽ+x7~rEA) @l>&-U}il_ ~T<"^Fg˹S*]cJJWp|EְD$!cp[N5pH^p.(ί"r>HuQq`YO\`6 W/FyγSUsul!unj0K٤Ҹ%B|t#mQ'k|;+Nb!]W©l>,YQ!9&D^}{~&iuU[i# #6f C)'Z`S-^VlvjM~nY-ڶ!pZXUv@:`GQ6KVך*n 6T!Mh@Q:Xy6-KT}瀠'!i)ZI}gmԑ:SFmNTJy ~6&?N⹍\GqDaeUdwfb7IBD˔n<12C?Sr5*,LFډ/juRB#UoA2]Ib8)AN}[N2;)~cs^)zsKǮ*\&[1D3uKT[5`T:ZS~?Yjos{84O(ۿ['T5}4Ds= |19k_'Fuӹ\|95z8?)luo}w#O'4k[_cZ4hѣF4hѮtg Rfw_)!1O8C<:uEV{=s|{= _-z;Rcp}St~+ۦ~Czco mT5aQ?ZN5Y, K^O_K/Kw} _V~_ɯef|EpQ1ޯ9(b bؿ__&~67_Y`J>/9f`Gh&?m?.$=w:M7WE5AۯP']wUhQTT4~-_cZcV6MCϨ|4N6TEufwXzv46Tؓm\Ǡ  6TE8$0Yu6v;ΰx8ɓf;/>_Y9fQ]91nIgAe&{}.=lHxV1a g7ܒڻ.KWG!6|UGt4f{a[ D FIY&wΨsKmOFe>b3#9ӻ +%_"In)@v )46;p^Ig"anta2FbO#ykڀ;W9k **/f&A?",) ͹8HU\٫amsZru ]; yaԻhs Vi6}2PWr_~YuR,P'fɅCM !Bh;˲jvGOvw0ʺ\l(*ŎC[duҢTnj.FMZoeU5)jz55VDF("v%^Mu/W[Uet@(QRŌ u(i@ZeiM@<A}d:L~BZ,u0BiZ5^MWۭnkޔhѣF4hѣF5З*?m̜1~Ƕ܁`d×ԑ@l2{it 5C䗬_88 g`Qn2 gdBÐ?Fe5UН_N{_u^(I6C_uտ7JbLw:T(v2y1(H̬T6-؟J>y5W|o!*#Cs|)_$WjX6IYj^GZlK`x qtz.Y j lIռhyH_dSAbkcZܐeb[%MkEBDSdߡ7oV'ڷ9 : s-L6qMgX8Tȣ?.-y Fj}-w]󯩽4h_C{^ f41i 崶Po>|8ճ7T gowۿ(j-^9)Y=Lwx`ś6,fiL[R @9 d͵#jȿ62$S,-DcpGMmT!ܮ1۪& eoNAWNcg:|( ,ty8,6_=x<<5#~"LCt`ZRs3P!)#*"'R򔴏8>(,>F:J$P%T]P`[OUѷ Lޕ>Ϭp:wF9wqyb>HH0!K9pD#H(Iw7vOG˴͚Y4J_2&V]L9r.YHm7dqR z;/˔jyc.̲\VdTT2Cml~1U]АFNxg7gI(C6͆#602^uIT;aq˓w^EV qT[1+ l²I=]. "#Pu]:ԯ7~^.";+ſ%3W5=/ 2J>Jn#<;]7Dؽέs+ݗyYkgu3)@n!lߩbzrͲR׏N8dһ|=\rsp/aJ((zde<0fzDž5ݱDؓ_ 4/=\T6.XfAҝV:rԢ"_4I Mquݿ%G,ʈ%a2\Vvej彑FX8@d ܽՃ Vt ISԜ$E}gry]w>;l[ς+ mɗdwg >>m,:|]VO?kĆyuAdy-MUؒyC_yaYd+9Wų$t1Wl{"_Ֆd9au}C{8ȬыUq"ȋ"oʠ""&^Rl0LrFMs}a7!D6] Rr_C'KФ6Oq!#3گoˢT\+,m.O6(eqU;26({jpåY=|te~y|?k}_p5'}V|i 9/yƾG(r!6m[/%*ʿ̾BQ5vKS~thѣF4hѣ_ 8GEaF8T쉐Qktva8_\<:iO8JM}vl?yo6Ƶ<3s?quc~\{v!N?G՛ՆӗW/F5hv v)bȷ_Gw I<ul̞yZ񧯰~?4M_W??ۉnxsg߿*{s2 D{xtu-MaѣF4hѣFs'qhߌ5?YQ/!Or#0|/|m?d̿S5/ǜRxSυ La_Оca!woξhѣ_*f)X;l˲"8ԁ cq.[9_PPa͟1/>gY>KW|he,GjH͛jޔmbT"js)Siʭr*Ô1%M]V#!A!_n!?_s~G϶lFkqRVfceO]>\RQqa8I÷Ά7-}JsΝJl(N S\[:jsJ"M}qU}3 1*QMB6kTSzW&o]yDOȕW|]Ma_l?ܗ`5u&>&?!ջ %_޶*8M QD:W&Xr;qYd.EyPI&#@MI$\EBoy?0I{7|e?,.UFKs38_Ѐ -Pz5)rMTa %\ZQ]u6|ӧ}w !һhwkVLvп&g5\_plW,~`:$é('Q -t+_1,Zg&^4buuzG#nOgAQ[_ RFjU69w+n}ycVB//! WHQEd/⍇ I=5휖t ⊞a 4g l9$fSC&*jiٝ2Kaq @yJѣF4hCcp}|CYtYM>Liň+"dG&c<,t̀)"*2>.=-|fdwqyXF3l0$B2XNAi:DEPRH6( J|,ANl$;HpQ޾fcXM1lhcEHM3f,@3k;+H= :D:=}|yUckltm }s)")ULظR z57^^x''%eYt}cO+U|NDmEWWÍ ǥu$W+rQ}$c W۾7ϛw3;S+8پ4*Jrӈ8dMRMܙc fQkK/O2a_ >c'<ϟ[CPξNt'?iǿ>]6k'u#2rϺ,iL_y^v:q -"XJ<.KD:f-]y,Wmծ1ʸNRJ]i.ۅkS/]}v{ j4):Ot )6XG덵 r1)r^-ѸlJtiIyQ%GpLwbC"**"cƓ Ls#dGݍ*,bLi,8M?C: &BH6D$`h@B$*B6tfVC]c]*D ݉6 ؎yPE Tg q01TTEEM};\C3ײEʰΰF< ,/\w7@M 9lZ'?UŹ'2h7M1^̰u1 Pb:o_qSHʀDu>FK𖓱"1h: flU7)0u_&q)p.n26yL&H?*U-@hlquPLhGd".ujuCO矮kQ_i?_T5aE¿CpZr-t'e>=X4ha~YmW#9##`Su%URԵO90y^j8wi1x?|Ȧ y>JE˖mZS5bK>;AR?Bm5|?9QJHcY p(oKˢqJ/?F"*!뙰`̳;'J FMS% F'{UuhpX̉_eM%p*oI%b; x:h"]FmFj"R%\nse_OUV 왳>Xq#.?&C)H۶8ͻ} R8u&^'SRqw[pސW]{|2~z'!%ȅ)c{ϬEk@c6:O4̔Q_kUE_2__̪RU72WJ 9?nT9HS֙-1,U}Ro_:gZ\y\Bj%d^8uD6^s5 ({ۿ)5rːB\"IZ*%`SDi-ɧd5(O\o׶J M"ɮq}ObyFBocW;wuŕ$s!8fEnx[LO8yo] G:Ӯv4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣV[ea2v?G0s$]s)fȼ?o_H4D[eNxD.v-r/7;iHdCADM%y&SeU 'k_4hѣFm@*. Z؉y+_VK7_jVo397qkqkd=ufI-1?݈G֚K&Zo _@y}a}0OozQqbܧ$lH"2¦KkYk3m:QZQOUMcyҒK; _F׶[5 UES? }S[-$ :AO.-[*}H)%ɳIJ[o\Iԫ%6Mc}u綾;KҀ;/EZ*'y/g.>gc*[܇Uѥ1MЀQw%nZ<BQ~uEC.lר6}z\U/TziE\M_q臐/oikY%ETEk;-n۫]U{u(&^y{W^}By5Nm&?R}ZH>#j[l) HKȯz()x' {<}߃4qE"OLnO1D_wob+KJ;5H}~dUu EU؞n~'IQe'e.EIBI9 54~|`d^DE|_%{#ȯI"54zs&R}wQMېp8'ĺ.gf"`T@G6&4NKȦPT|I TF܏!֜~һ슋5õЕit#,qG Ex **e@y^iQvEt|<]'CZ:լboA6"poӄa^][/WJ(w6NNI;z}p>7Dti7Ex郻YW2{WY)qDJK +b}Î?O7"4CT^Ȏ~*=_ (bB*x]O9ZӞDu֋-t| t]vCZfnfhb=( l˯l.ۦS.F#҅˯V4c.&FV͓~wե/{ﭔemAٱmu]׾Kڴ(zj=!6u""" &ȟR&߹ !IsgLzwwåEE>{5u!'IxxmtOfAm|gLzU}U /As$WSپg޲|o_YW?}C5o_\m͓'>4NN6EWȗ\Ge0l:I{EWxWoxQ5SyE6_U'/ҺaՉ>93>GxAl/%k?> X%S'WHt\!8_r5d?x}?P^|+K}~+z=v:};Қݦwݿc?ڳ?w~~~ ˾~?oE-Sg=ۻQ&9ͻv_;h5\lw6/T5ۿe#SZ=ƻ8OX01n!Ox]=cL&+쫫'rr?g\#^qgB(3^V>> 2g&l:`#/컧\Tj|ew7 rrm<_# CQ[J(|c<[M}wuŔ˞[*S;? _kgo_H^Y?gpV@iryZTc$7JƵ5!:wȬܣ쟝FW*Km} +Ԡ({3UwM,̎x'f%z9,SK12zV7X#o#s>hl>q)OuqH:Sè:_ zuk):V.;QTȗM4A.ɍThۯRzk4˺tsPů{\J53v d14xۯRt+|}64WbTT_gd?5VJrobpyP/{amU>E3EDA~_j눝yM:Q|aw}7GI}EB?Sٯ,*"o'ׯU_=xW |i?&U|IWW5Zlu}|~b!Bߩ7}~~Z+ǯU]ykXi|TׄeA7/˯~|;? _h7/ˣGóvI~]5we>ȟ^|) {OOHp 9(4we#YΝPnz>\~;\Fφ6q/ڴv2 ˨rMe%DUFlV.ꈾ/Sء"xilka :7e )S1nIMWv6 zM/Qt nJH"*mğ9َm]B(In˸$[1q]!Fm\"%@AH6Mvt|W2$vL}PrʯsaCFAEz|dO>(y.`GU#ǟ{.if*\| Rv2dUb=t)n>M+ue,LW 6ebLj,ƌ"`,'H"k!D 1Č3,fQh[iA"iԗ%Q:A=7Eں+`SVWUDbeT8c71,8O؍ADM|FȸśgS3JfS Gb7 vAX(f0 ^_Rb*X"XG< Ӧ)yOJx"vx+U]Qg6\0(Lkd]pGqiߘ*jqgkTKuaRj}[ù( I(/ua*o]Zi=k)/uHWȅE˪?|}||FKŹȘ}5`&M̭%D_uW|1*SeT D_ҽA'Ev,/t<|S_uE_cUFKIWT{Ys=Uow#HHU&Kf>> J|b=OnM/,:W_2ukI59"tʾkw7>Mz/rkƫ#+-*M1M(l\.ƿZd*'ߚd*'osߴ?_IWW5Wt|@UwT5ƾ; z^DnO=׶hzwID*km6dCm'O^/gҿJ}zvy0x/˭e/ˬ't;D6pjy{X_6߷dWˎOuOQa⚧?1TD}w׷Q<_ҶF~#BBWlﺩ/>K,rm|U5MΏS:LD@R[;3Z+oj$MEMΏSzLD (n)<|2v.v˘;pN[ʸ/ߪW8O_>3u^y.CNs!7/[o#p?xKUiQ?gtfP?lu>n_0ר;UMJ8A|7ES^x.Λ.LJǫk6 P'JmU}+kU_~bO5Æ^k/Y}?^`ovc_gaDM_Zx ݝ \+|Kg'O*[vaVC] ˆ&ET|TQW/j~Fr$ܞgd|s_\x~2؏?Lg`o"#]p_.#s.8ȳŭXS$p#ҽVߣi|ͽc6l͹# }b(bhbDni?sٓ%6S5ѭ| kS7dެwU-K}\^lMY^P ]T~9!#IGFtuZm篳FïOT~o_LfX/>&ڪ"6l]A *u8lB":PJ1'HtӡKoME}غ2uDWKZNa6iK&KQWm}M)t[n⨈*[(x"v{BB2>{ .⨢'ʞ>Z֑B*Dh"(D]("(lE%"qEEuUUM5_O' *nDD nZz9rrT ǑIO - i`/*'5Ez|dOݟ+.=s+7!%@y#F N(z7_QW6D%ܕ|_k))z=seO!ecHP]f$OXc0BDTtDvcpc+m%r 8p}H,QUaEo8~M K? \.rW!g*謵^A(|Zfi &NUWQmCep-:[|YEYR̜りF-q|i5`U]Y tD_<(QB"Ċ1; 4-{5aQÉ]Q (qXW" G! 2 {4'&meUu5m}=T6 UA[[(zQ@qaĎ6hk?kýw5 !Vfm6*1Rca vAX~(ٰA+/$4[7;4تEJnB75_ ⍲nly1p|Sxr&cl2 0Sذ6a4r17  t_qc֭ZbP!8J"*X׍#k.3̚EƮ!pPUD_]cKX`K&Ay_TO$tɰ9%/V)1lk1h lA7֕/{Cઞ:Xgy,<%E?U{]ҹu݉( "TOI~]_3| 7/_X?GfM>]D$OUV{FϜTی=Үi|Un*FEOxZ1Dzw߷Q_ϋ_:Chԗȼ ȸ,6Ep_E{~YVVKYsI+.dhtza ļ<8)fAbz{U%IeZym4飹uImdˤ}d]E$T]Lݾwݫ#< ~r U1ό]aeKs;fF3 Kt(BîĊ%˱ h_6!"HCSz47&ImYWOr 6(Q-YF/kojݥ{䉕[V) {${؜z6cUDUM5Jq6'TzQNg14r1G,q{L"oIĸ1v.!3(]hTUQUU3Zޯ/d}zy*buTA)*q'WS>~^B4=E0rBSu1w{aushή0缛:1IG^.6XR<z N"eT'QTOUOpڂTD~cukkj0+<_7g /RN=*K_`zٺ۲<^s8=øJC(au*E-*sOyE K5KpG0z(.7FQ~[!3}2%ԆT[}w]nM %q1*pZ]|+jc )*|mL(re<s*$}z6D|KN6Io%_5O%- r0Ӝ/-|Vj<7Վ탺X>C&i[VWXj#-[ j*!/m]iշ"8%%; ;wp֎H5יr2{AUQQ^UMQ};ds`}LŠ/Z񝛹v8OZXGe3[bb3 R;{wktyeư/8 or`"!x\X.2wA^}SUӕ>{4[CsVASʌqߏ8zηصVewoX:mٖVS%Xʑ:te͝6["Tɒɕ%pȌ̕UUUWT&lٖS%˓>|Ν5eL2Srn?&L#q%35UUU]&)***ꪫ⪫L]YX\\XN.[짾8쩓JtuqR%UU]-a~Q9V?aTv.[[CǨjY-',ETSp#%R2ETXı<;ɨ:~E֑)hWYtY;h(e( ){ipd ]$Sr"%4>͹_88׍ly[H!$u |Sب?,ߝ/̿>b~^S9ء1sh>:iEco~0SulNhG[jwwsx6t7Efkni{N^rLNȅ\PND>T@'&ʖ麧 **/ih"*'71Feu=O\9 J #1hdETr7%Ղuh5ٽ}){jkNsRegx qڈz:X[S9*Aٚެs;63-M?mԖDq"VGlOf䊾Z{R=v%{CRݏ+QWxeAz{d1 [ISuk_$$HB$$$tETIHUDQEQvTT_T]T=. 1 0%E؄vQ!TQ|Uo%NEj[n *2XHU9Dp _lXaQΪ.)>g!͑K -ɜx2$Hc+3jHg,9(UrTzT ~[DKsǠ5+6<_h>_> T&J.PŠ#ƨJБQ.!6`UD>ϵ.]7%owo5_^VzSmWt"offu'_NKde|1 lMV>fʺm}r1/GwG]߯|t5ˢo| HuBrGR-LC xMD"Kåzvz<.Xo Đ=Q"_mdyT(0t B-Ժ6D^ @IY !oMÿ_u@j}WL:쿝r#!HHr(-zcU#J!ukU_NqQqcYli˘9W\NSVH4! eLM,'4=}mpkry19b$kc mcO%=iz\%WKR:\2v Qw(D?QT毃ˊ[4o) 3]Djt+Ek!;gs)Uu+vWJ/8vSޟ7UƫeƜ/1b!9fxEUԃU7oZRvE+v"/9/o74Vu5Ӝ>җ%DSOx<87W|^C9U}*y2WeO|jk_c_!_\K0!\NGLOijpwĽFܚMt *$!_Z%;]oq}k# b~1U[kw!p=*==-* I-ݥy$/ҝRIZH53Ԥd*="*qKPN]u'[ٮmr$K.} &Va|{["`6/< uEE_U$z2aT9Wٓ+Q,4UUtmƝu *Ҋ'ȾDm5EQW_^Gߑ!v~]&y&KLC(U_qŧ8PTT%._JZ4hѣF4hѣFGͦsܥnrEB]UF1+u6p}I;(Ĕ;qtbNa MLRT} vB8)зMTQvT9Y6<ݕg 1ytg'µŸ?Llߙ $;: Gtؓ_Zbɲ5;\HQCe@$IhcisA- YQؕS*:H=pTV شDȋYLx.,yR_yZQؕRMAR`,A~ b(Imv^Kb*3M$8[?^>oLI-JB%Тj/]K=4hѣF|tUCv Kjg0о=E&4x)+i دl( IЈ>?=H USRR%YkUuwvDSrNE0>-)< ݂BC\t(ǫZ3o4?y!rWUmzAFU$@D_}|k_Q_?#.UH:=|k6!x]JȊg!ys\tnUPgp_A4$ mIQSm6U[7Qr=,PxRl6}_jܕde]atOd*j˪yjZH53Ԥd*="*>to RgC ,{?>aʻZ/?e|k#_M{ᯡ*1Xue;y߿<;g#/5/y=}6kcVS_e4hѣF4hѯO2aa_y'uQ|+jGU 8[ BϙWz4q%?5_ZdM\/K-ܞ)wu8 q-~`ޟqucymq'n-=itz"z~Gk%|O[TK& ϟ[{Ļoxlo8okC?'Gy?_=ey^f\c䓾;$fI31KhNn7=D\RjQw ҟȟ43S7w]^?Kn7=D\GjQw 'aM|oORɧ;~jN}İrǸ3d×#5چ2( oyW: #P\5o({ǡSbx߹}xPn]$q(XMzjJFԝ(/V\|6+7uwê;u͏)|wz[&k?{ɤfGPx}p]zuV5)K|1{HPMxl_XOŠY}ѣF4hѣF4hѣF>~O7G}oSՆ  ꓍iˆφ'D_._˗О?ٗ`@cuU{,(ܞD4W>cMU25ъALn~]LH5R~Ojx9Eoa^o X:LFqUT)MC#e4 oj jUOu HL'֎K7kpyr̻WNnAI> ۶\c@Sڴlp߫ 8._Ƒw$4˩Ȝq!P[f} : ؼm{51͜|+(qgXW1 mN WZ6p`շKjA_+D!q b"5'zL}9gJ {L.[bCnЗ_.\Y0%I5ḃ!p}4Bm]MSm|ɍ"iQv46py[$BZpI6;HDHI6!!]U5gAY6emWXWʑt9-2bL&,M} 1TEEEP~NM߇ē!cvCw*#y,F1 W UEA5QB$A.|Ix˼*?TX e=`W 쫫Cw{Yx93-i*W}XƓ0G*ׅrFioRV\D) RרߦtAiEef=w ri|a#AIJ(|cWK_Hw۫eT_}Nkw[P-O =kdkAԮ_/d/AF-Jo8_-3r}G3'@5"ŰoHe=7?/hsE:$sK &DhdUVrY?e ]'_i=w*x\[ VT+&S'BtUI?7t;;n{* NOo}ed669,3<!FAū+dHrDE)ku 3bUΙ[c }|͇!moyM|[PgM¶d 'AI_mz~4 yMĄ|^qƌ\hͷ@ȄPMoQ¸Oo[%֕s$W!*3&,7l|Qu~ yKU`M&50W3etA2kK_LQ]5w yIǡM&?ʐ,etA2/^fK~Yzh{jFړ>0l n&]vĢ+C:;Wr;6K}6=E7lQ5^~|< ɒ뱞1;.ez1*-ÍK%mc@b%QGUz`u/a{p ʃsv3a}&$bSV"I(7*\xQѐn(YQUvPu,ٍs+R aIBe2vMűè >Ѧ{6۵cSO\vǕM"o|&N%iR}:Ynn)&1[EY#ֽɠ(ZȱLYS^ϋkQk_(k`I_lI<]j+j+xϪʮ Cb\z,&B些ĦZGx_au[$MH <m}+V1ceI]qHWt7S[GbXV&-:ӄK}*k.hѣF4hѣF5~5uxP TV$q)dnxn)mzӾSF7IԱȉAD~"R]]s+ [>VE'Tuٿ(y4kŸCMi|3f 4|f\VҢ#ʭscQv joMH㶰 j~P$",XBut˾V;ePܳuW$Zr.[ PucEV6CFQUSW8AWB{[m=g0t~l?^hqxxwQ,$#fҿ2y` 6O(P`+zD\FEIS]*@#4hѣF4hѣF4hѯOt]IPNZ#EɈa 5[ut/WG x$KM*V&apE_ȋY~ =k 7!|$2QmwyO*逧]]]d)ELjTC>$saD.-|j_i#*.?z- #sg*낣)jZfBD!%PnO&"1?s|2WLU$M{a-! uYzC)'<W+ jYKNScVZ!.=?=yq_f;^1-<AFkK\k|w-;#ϭ`DaLO3!jsz2.GT%U$}v?Xe/6DqSI>GA`yy'eAQ]\= ffH = *v]կ|te~y|?k}_p5'}V|i 9/yƾG(r!6m[/%*ʿ̾BQ5vKS~thѣF4hѣ_ 8GEaF8T쉐Qktva8_\<:iO8JM}vl?yo6Ƶ<3s?quc~\{v!N?G՛ՆӗW/F5;Lr/lwÂIVy;bk,G_/}]v_ɞfv:KЏn,#ۭEkVGք"BauU|:_n9|;ﶛw"r1䳅q/R%sS>x7}1ɯ}jk\g/w s?<V~;k;/+5Ɵ?܈L/ w_z:g}w[}&pԚ=as#n 򁨎?[U:Po{ǹnNc7'I"ga\n["ܕFTs}Po{NTNt@~4ʸj0M̍5@c:ӭ"u谷 |Z,ǫd0La4p2 f&e6TEK WaULC׬  ~BјTEB,VlVz;d*cĂ~(#0ܑUEmv?;dPwSbw#ib^n8v-UGuV %/;Ni:eV6V2N!sNȗ2dJ}72#3%UUUU2eVΟ:K'NL)~LR_#zD3tLq#q%335R33%R#"]WW\mom:]YO}S,'JqS'L88ㄤJ[pܧ{(rl+GT,-ml"Ď* )[m)+☦Idxv!M?!2[8T󬬦,ƌhD(J9VÒetC㮸"Z"x{ٷ+3mgv5q]ݬ FQDPt#2#p>;톳>Yy zᚈAʐkdzݫ]4q-bzW&SF[!)8 Vc)@~ؤ* 썂슠ooŸxBV+\䜧z38}%"3(}Z>$ǫ|(et"#>CBlȃEz]E:˧AFIxe,Dek:ȅM H~"Q]]ϓ8\v}_A`S[ >> uGO\#'AjCV~Mh7+`|f"׀(V҄%񳯔mS=wsӻ b*ɹx.Ć]︨& RG"]NRp1P-Ek4RtQo@Er67X|A6E4]nM]}8róﳚ2$&-M:{̇8/"QWǦMJRT}JjkF4hѣ_ Pƃݯ_H. @-M6{ t$%z$ƚc}MvkGݲ.]32@-ENk2tUoPQU%ڤ]cа&~s3P&&?^wDb{)oa=f=O'),cA"nJk=A7B2~JwOZvy.o:XJ  E%.Cko0>)J-|:/ӯA˾O&U>arn1 QXn(Z@i̹S.׫DG_ƟdS͏}ǜORygQw>υo C:U 8[ B'Q?V~Dz_Gihoc+lւ"q?3hJ;(wă<@znE6~l/w5gR@H'73+;VF=pg<x,DPFT j8[XoNԃbmu#&/"{_# vR{ص@n`F+ՖnZ!SWh QohTۙW7rN xl8*)]"q9ٚ%F|iX:Æ K{}^F)'r<$ɪR4hjXƔ-jﳌ@ dX]Jf[+㲛. "gI'US\n^̸8ϛxofWc8v=A,ӏك%[=H/u%ME,oxysy9CZ"a#cO,$6EnC&*)z^\1wQɫ\ڐtIrHHAUQS]uW_mwaM&!F(ɪ'S_֟k;) inCV2U$AnMJ! 7|:@}O&U1MXn-8֜gbKE-" C}v{t_7LDͪ89 p 2pjyS^!4o"vM\/#0.[±{dFm1U/oua5lTF ē1UDj3&;..YzI弩g /,n?aY0pYqlz{\,3;}{"ֵk`J⫯l"l,wַ/m+W%l$YNws"5%I%UWuιr]*Lשrxξ:&k'w|朇YydyA'.򋉗:n:^JK|1'!,J*qy9Ʀ)jb7<5iUn82,epӂjp&$fRۗ࢑}1_'<4㚿3lz"[a<'<\%8'?Z_ϓp_2npGkƢy3$aREɖ خ q`[#I5: ;83+l#2YgD|Pؕ[&ĘO '_l!ű.s J:3ExPٓKDĆ6hI=n n&@hBB_Ԏζm=F'[eH#ÑfD8Ę*ksMe^*mq!ei+J5_N, &Ō6~N6hI੯`fq_+O 8&sntWS+$Euq[?#BO;.뎢ҭT* pHBh&"EKlx>nfjw}ǦuHcNmDWˆ8xj]gׂ;ݐk("!bYi9 5K1!!DRQ㔗;Dq_OT@} C2rs%oH$B$H)EYmKLX܂n-|vE3;&>l}K(T.lpZ0L3׷pdɌ;'b@bD)'*ί4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4jq̯,5c<W(Fy}nğˮse͑F{|YǯW?ZOIw2F:ѣF4hѣFo Ykϟ_ѥ(kGWJ 䟁?sJy~!+4?-gWZFCe?5MzѣF\.,n&Iz5M;7_x[ YmXV-*ѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4j1d'<᧨EKuuzTQU%%ώźl>^~z>CU-_j~YݧIG:6Q_fFi[nlJ>*ibxnKm5'SYw}J*bk]Ym|ߞdG#}p"w (TU.U4O5Mr ]Oqq?$:W늟` D è=taLVU nE-W_6Lđ#/Fa皁KE|=pf)Zi|:T&\u)k7]L Hrq'D|avkG7"OH⑷| |uq|FA~,ƿ23`FmlA^"oLBTE](^.PMír5U$_yvȗ7dWQ~~@H5>IQb_&ٿѧ>jl7k&n*J_gbQMI۷^|q!u7_}_,ް bʓ+J/W_F5Я1f>BM'5s)&Lf}>%Ӗʧ({:2 _'?>nFm!!JI+<Et堲*N+Sy/+~w֭|;ĖИlVc'഍2KEi&vQMA5tB~U<}$MM~I EU>,-Ɖ@V<}(MK~A qU<DuD*Q+d}j'־KsT_j0ï5?:˚`bn\|6m5WíO5M}Bis?}o95݇ =?#:6]Gb}Î?O7Î!#kGk*=8#Nrû!i>B7si~?_c?_F4hѣF5? |LSN9c\|ୀSV')?cZ{ϮfGpk֝ӊrVŲ<=+_,smWg!eY'z%|Wti? ׷_[oһx#۬7nAo=Tmבy 5>OS[ܛ>+>߂߂{z}ODw--ڻ'%p$<|aȉVK35c3_@zkgq_g? ^9t`G5D`r]*vt$||c~̯1__g9:-n<0+LC m2]{QmLw2DQ="qvkU[7av81[ZG$K2D܉uD f CUBE_4ѯgsv1&%TǨy^+7W{TײTwM lgGu' S<56+5Yk(6c.=)Sb3e讨3FNIm1p9R\]YɚBݯ%ԇO]qU[f!rn' N6Hb63]=Ȱb: |ǯ桮|l}q$4X$N *r,W}UVOMTz?}_]~ 1iJWZ D.ݞ(Cd"(䈛^Z/:?v|xjű2L)UF99aqG|$ex |UiEME^4_O4K(O] :"Ium_uQt\n%gUs6<5[XήNe|ɸtP%s2 -D]rW܅Ƽ/vufx PJ8VQwϛS RQN"DOd̔:Km[U:7!"'"p gQk{* .-)wV6xDտL[T.Kg3K?ť[`sGwo^?ɟϣk;\>߇G?؟}=Ns_{.Kg3mgt_qhx?oIk}}vkǓʑ6t2d.\4H*CoH!S35R2UUUUُʓ;p9d2d3.\&T]~L#utԌTUUUtq63DD2DDxOn 2ϋ ++ /Ma>n'S&d$%̗!q\"7 UUW_6@M_qƾRgrO 4Dk"O_ίwv_b?8k\篹~ӟUG NE|to'ӶyMhq|W9|V!I? wOy.E}v*>߶4O??OM6ֹǐ['NE8{zS]DUFxܘ|=7`Qlb`tNh9XLbN4(nzS]DULuP4^򡯽t&h|Ϲ{i Zbc.xLOY~mr=ysaeᔪ^Au(E`U2Κ" ȹ 1a}Ur"nmCLs-ξѧ%_u1uE~帱eغcs&KC.]>gTCj{|8j9s9F4uٶcOqOH{o QHeJ˘hzCnA\{~&ߺ:e꓄K^ &rq4>/dyٮ)$Cߨ1[4UmN늚QѾS'!mr.Pԑd7+cb# VTUDDOߖ&)]oqejjHɡcb" VjTUDDD Ess+(e_̗r apIlDTH" ""@kO.;do7fOSl_;)'}_s[3}W-@:˪qѯ 54hѣYk k3m_Mfc+aֶUüo;c8Oݗ #׶o15Mb}w~O7:jK56?Qg{o3Jh|;ʑa4+.ȊQWPϓ26pEz@t"*"*О:Zq/tyFAcwcS'|$WJ:$͓У8] 6F_Rro!_+O/䋖?az?ޗ?AsW3UNM,ehHa|Ð+$:&k-| W-~"|j>N,d!W'%d3GAhk^u0X3aex i]m֝oqD0p QSe4 DDTZÃI~]|w?cÀ .EXC`p+5ȂIڢ.̸m<ˠMӭ٢8ꗺӌ/6m<ћNn6dm@`HŮ\>_z4]&;1";OF8Nਐ"ˬzXb;d{QH 1r<|륍-H`t<Ɂ Q$CtVHMi|~q.i2VW~^6urCPX X²N>ԁ|P?h_Kt Ԥ>m~__f܋`(k!'W /*>}'?$$EE_b'ѥgTT_b'ѯEO4֦54hִ4ZH7^_b{ Ѫoߗ-!!)ևyPɳ5kǝdPv-Ot' *Fﳖ.9YK8X>ҡJ:"b* 'F)|xy|S!~*ȫ 71ybQVa@o LD1jc+)DP۬?%-Pr1#E60p6I122"jq@ۄ8l BZ_je)t!r:Д*xm\DA!&,#/@SDPm;պ =igs?__(_IQs XNBL2֛E;)܆d\3!֨qVqwܼ<:N@<6ƛOHT\l3!ײP}^.{D{WZNW[ &r]4?My'ށ6saaarT8EVT}q9gn,nDqnPѕ/j uR*o(n8EH[CSFWԬr>FM8=R( &F*&*к_ss,e!3%Eq#1tMq9 (Mufih9ˣF4h9ˣUUlrɪި!vn\橷O?Sf5׻ėڞ%z1Uzw߷>wq翯3u$r/Օ=AO*{ V :z!iQIQC(p {xs*2,n¢MD[uQW!'6=-""oxѳD"dh*&s9acؘ:=R.L{Ȼ;+%\eݷg[ZdIB+ g!㻬2u8CB[Dgk[} ] Z\Tyc0r 'q= " m57zS[{o}sU>N?3ݞrSV57qN]ndr\#fvByiWPFm:ۍ*"l(ћn6d@f* @bH$$*/.5'Zqe͗3i֝mƜl  QSW/y-u*5͸tIJp>$Ht9 0𶑛-yq-hs'g[M6c`z$G( g]\GWqFMsmJ0JA= ze2~}v1ԪagU6'4rȬ5= X%P?5j%^~dQ]OIzX _%$" 0{wU_o J_~1UǯZ~tq|eLw]7vw_~_ݱd73_O_[oһfj<^=ѷWѹտOW@]+{iq#'?g_s'ߩحM_xo|w>};Ο?A??N/ګ?'zuPgZ{6ޫ::?j(,:?^W$6O2}a3?Y4kOqg_W_ܩCmg40y f[aut6ѴrTٕƎڸh;"nk]/y=sSY c_{wNG8vittwO;ʃӥ܍Ͻ'|DvcO^{GٶFlkWwܕw.zz ue^]iNB?3|z߁K3gӁO~q% 'G />ezMB&ɰK,z2: Gm{]iC j,WMU?eZï/,}siMJ¯cqe~-؍[#n2l_Bw&舫y)[c!8oLqh٠;KHOw&舫F9J$&a>5lt^û/ P_Gw kܽ9MǸ%Xs֎.(/x>KJBs "Ɇ122ml}4mYi'u DQTvOQfYzKGӯ}a['^yIh\2DDUU]Q )**숈*hfɏw̖QŌӏɓ%#a7^}MQHQ7p^$h5q)ߧjj1.l YUdm{㪩:k_Š,LbY7&Φ[iƭ*OXZϸC MEQR8.i/>ػ~h^}1[!p9I7OW{dZcbE2ػ)g>o$!6ɰQ\0BEN҉"ʏ\rKrl\@ER:L^E3 JnreW>AGgd\ q<3*qRU:TtTTD$.|yI1>6\XZy5rt8ir*I**",6ʫ2ٻEKU׷e_^8뾬ׄ,% U=JȾKsR@SBdʩҦH(h_bջ{ <cwOɡgԑZpk5oҬv7r&d.Gt6\s~s8F ]՟W!@aɇk~sc#wJ^[$/s\W rDӁ .|T(Sf+= #w}|uͿkO"qw7fUܥSCv|?Zi6bT=CaM:PFOֲTF/1Ȭ 7X5!j(MN[dQ%wMz5/y⹶SWY2DGrc z ҨjKm'`yY9ٮr`n2FJ5",']Zhg<Y[q n2j0y}?ۄ 7ТꚪLgǼ./L1_*8^PdN0ƈS\AGx{DѤwƣn=yE ܦԓ؆?N>|L^ CgnH_+_UDpaх'$yJ =*4mϲNj4OGEW5qP~eg ό.E2,#̛e79YDp+vbh6= }b|'0.F5 2nTbvHi:J+@ [xI(/w=AYǷoҩ_KV~Zq.r\TDw8V9ȸ*14o][52F4hѣF4hѣ\F~W˓֣2 %"V ~L@~{s7*r2g Da}V&|BFilA W^D5nrD^Fن*t'Ầ|ujc'<ϟ[CPξ?t'?iǿ>]6ԜS9-dksiadI > s_%0mAKB**iQƼWǷ3[~bU}݌͇z2Y6Ϥ|QS[ZIh^[>C'0:t I jQ8? hy%?}9e4iYS* \2u؅Ql)-RGyw՜H7_ihlVu0t!iS[24#jG|e8|o9Y@wrpoV[1;F=w4MLuQW-!E 4B (p{)r|i6Go-iYuc0m" *o끠Nk~S!K_dy5&*"Zxx{qwƲ\!#cLO~>c1ل|&:n "_FZPFd^&F#縯>t7"c|4Vw߭༩6F|v0Z%nߔ;]un}@ (&WEB4QOH v!v b A+R$'̻z~!|<-|U_:f^+/DQ3\1MJADU=D>mG6_qՏ¢53VY QnO (J"og|wx9;=Hz6NJul^ɿ7%JwcY ]$&2r$bwChdG>EW5-X}ykUopW-~1o 6`\gg.0jUTו t.<-* m+psncu8a\ba&)nL⬣Hn;bnuS,/n5eteǁg6# - j;H(n&?.Ua/pC]9q4F9q;"؛ltXKSVVs:-*/v?\ۮ=7y'u%Gm?pgO۹ruۮ=7y't~%Gm?|_$7Ʈ˷3n;t3>.3acy?1r%5qbZSr#+znc(ng؟re65s6enKz sKH[bƱtu0uo <)Y@z4{x='W]m;!nGx=gVIq,?3r^.](7X[:В.P&u﫣O矮kQ_i?_T5aE¿CpZr-t'e>=Xp+.^Xxrʜ}OqpD/&GZyeAۉ;Q]8⨒ ;wb^9pE[V}Ɲ45Xꉿv ">,jЕ=d6;y3k Zs,Hn#R^%Hd3 pC!_yGs_07O=Ri.2ngq+6"M*Ȯ.k@p[W >Fh}ͼ*:>WC> D*ܽ(yx  5ho|ȅ\*mBedSwO&>#QK[PP]^GWa>wOCfƮ-u݉"awve6ແWr%/q*筌r&8XvKN]}kԉjS~?Yj>qiΞQCNknizcrLNsB;]Vsk"qGRGfNhܶ5s50hѣF4hѣ\4~5dͮ9SBbqyt'U{p2D{ZUu>9y~9>UwAky'}WW»e+3 ?U1L'?z~/_,smWmKHez}>ð}]~OWJ˧Ɯȟx'm}{~b7x|W}, [9>f'U2tF<HGʲ_Z{kOqg_Bp3q' Kҝ0ڧ(z>Uh=?U]7{q SUA(ͳr:m-Uh䩲Ypw2DQ=/-N{zzó,1FֲɴrLuG`s$MۧZ1c[=z)9 :h"uOs//&Wh9j+WWwTװTwm#Ӭ)ÈҺ)HjZzוV:]y?SZٞr.+{xF[dXHl0$pDIf%gClϭLɌIlm"bBCaS.$էN"쩺/*n:crdmɸwfUoO[ڎBie98Ѣ#d.|wSa2,#>J/nL5U8x} 5Ҋ1E}z=Y;pc/dYҬnsh"9)2UC(modQa/R0GrJp88n;UYcPNc*k[%O nMwkn{ k9;'m%j KOHی<TB-v)N=}:F6 !h*@B@1qL  THHWtTTEEDTTTT?:휂Ken+=eSJPu.Y8]_ĥaQg_^хvn1)Wֶ UQ<  )n$HI䀦 m'巆];i>| l,l8LƋ'g9k8-'*ȷJ3|u\m$b2xJʊj||#~mg$F3} ):үHn T`DUED1!UO NT)Jr :V\;o43a<ҪxuI拮a띺5}|lMWS?ʷyeCR*q8ޙY?Q`ћ@w~EnvMVrHL|j]v_jp0=l׹{sXqK\Q^}AǶ>TD% ?)cFed:ټhLhN:*:̲_ NΒM4!d"&"AR"TER"U;2ȴeivSsx|B\WvyGLsWYǃe|gUW1t&訨H]*b=|m) ꧦnܦTQU 7?2u ?Qϛ/#J}Pw\:v|U_zzcoșl, 4kXp_1k˸,i$9 ue0ܦؔѓjHh lHsdppޝC\[jcm2\_C!$٨)! ěG He6&NG$.{*jCĸ30N0L֢4+$XVKVDzeҞ~u=dȭNj,\&m%MUWl)-[Gyw՜H7w_ǴC=?Ug6w}̍.ڳ&z>=/gGhlVu0urN'=Sǹ5Wro N^Huu˲xk(=ϱ*l<0?xT/]ذ~.|&@^ܶ]R VX͙vU|}`>R{[. _ r (3n*>8oSdZKc[ j>!lWd]_bս 2~qp]\?k՟q"; 7]ީ4hѣF4kfQߙr Wԙ˲wzRe;jmx"6ң3&JC[0qÎ%XeבK}dנA#2!B5E.UDRxSd]nWMӦd#12ģ,k7"iE"Hdm>S_r_/{OiYɨY"؏_;rV'ӄDp=IDUEt?A>pjP0MiYRّYb jFj~cTՖRJM-kF~0¿47"OH->⑷⁩D7:OQzzUEWOU7uMն{B^.6Ãln=>0`W2=o_[zxկ4hѣFI?;r* c,̪09 >%bU S?.p9ϼAZFS8g,3Lq4!>*z.GJRzֈBJBKWmhvҵ6dwHqgZ6ە["1qlRu_?8=\$8u*!US+jtSU? krTo+!Yjü>DD%E(43a<ҪxuI拮at_ UNg;~x?Wq?IF>5Z\Tß4n\.uk{_t_'/8{sӻOG GYW{?w^YasGi~Gͣ 2D/W_ARWQlN*R}8͏`#]svw#ᾋ^sEw7K?u؏lr3ɉLZ,*wқ^/Ű**TG_V>?m7f׬ZC̿# 9~Q>&,=7uC{7skq vOmlK,a%7UEdEj[S}USqIvM}([8h,CӮ+9ʫcN=6O%~nnjK&'d~/!+l+WX\cBefo.࿹i)r+NȲ6I$bDI/}3B`ECGҪ}5?p WwupcW׵ TG_WǬHy!?Nɻ39OĴwNKy'އ6g>YQ,H4Z}kkk+exp7!m"p7E" vcK!BT@0?Ƌw^XLSϢt d0.d?m;)%BԨa0暯RzZ6MXO*~q= LTfYE=_F6#V"L@G' 8/kZsiʮHIv9/Qd [dFFɕQLDB"$bUTUh|' Igd;O VDF{&IM)6""MUUE]t RrMs w\dX;oI>_V{tboѷפLJv>^~hClvֹI"j/:UuokWnmMaA%"Tn6~B<|k:|d|<5M<|[ĨI c/&JLنHX<h] Gq)TQU7]W62llw& *t!Œy/iS+|e_q(dAq#RfTY %oS% TIZhuD0C_͟]O8gqqZRR#\gnzm2WYshWDTT78JygC39wILVTIBx:KI3?U=8~gx- c ?3'@㾌w&\.HN8eIN4"=j*e0Nc_o_]D7~mGg|S6wDEUmh7O㶶&FGX@DTqtm|t4E<PׯVȍHyo1"'|?l {֟2C 4*/ OZҡ"쪛~vf}vrIY9bwˏ!+c@. XKU HW= nFt=˻OrN09sVKn1\Q,c4Kq#Om\%9I7?rG e[QA5uRTYӢD. l?%qi %IJ3s e[Q—5uRTYӢ 躍dyM7\$}Jr.t'pz (3Y1%Eԟ7Xu<3m_Mfc+}u5<S\1~&c!g$Og^M)[8$qc=&J"㭢) .~p|cHA3\עJ64 Xc hBNSeHK\ lY`0B˛l%򥄳`^l܁ N5~C(`Io}:5OA=ZM"x 먡tZ6&ET ޮ8EmSuET^0 XXd}u_N 2*]t(Kj쪊9CPWQ5s?~`_"9J82/G q6()4~lmO MQ~W>7̟u.C_g1O>as'_ڑЏo?F]Zssk@!Ûd?u˴?ͯ}iaF4hѣF>?d&)>|?V?+ib[1|u=#O]|N| /LJvne?=\k#ۢ6om67_cܗVאJ~%GJȾ;x^Zg)}xT k5)"Dq|*l6~lUH4TTْ_綟Gׯ>uK4hѣUK;6+@$f0m?sAXCLz@ٽiT m"*Wy.{6/MřdL4zڎYOTHhPUEED]nA] HQwTIŒ9N ʴ.DL:2,R MyCݐ"GP> E&F=ƽM'$csezG/ LFddoHH5Gx &!bNAI bf̬6Sϸ*1[~J괄ᾱ<=My{Ǐ5+CgyҮfluXI*(@fbe#uXCBUuY$EMO$DѦC"~<KH2QPrU *y6DI\U0"C&d n0զ3yU̇}w5d]rs]b\YM?&Eb7nkz}^G^'/'Q6MuϞaoC&g1mvnJ3( Kz4+OM= pƟgkF=a4 j=y˅~yK(FjҸ~j2 /U]KCTOx0I>jf #MnRSG٭\ K}MTW m|:gzHǿ?lc{Nfj1WUM\ bmF:ɨ _U>?r_t_c>;\GPWF_.o?Fk?QN8ʏ^pi0?ȍOinLGG k#]+\.;*u;Һ`/u 2!:ӄ&bL'#Y7U rI __5ZrkKVQ"F/_olYō;Y9]"9 */rzDc#س) w HrDsy?UD_y!B%R":w0,/&X02[jL9ca;% HPQ7ӤywU]sWotO 9e|C*^}&ɶe;_>}g_wH9wǍYVM#F2阯zfvI]0TU<4{f9C,Gɲ̛"b+V/o-ٌAv.x) "xkD42S@ym.]$h2]ovD6.l&N0A%]g^Зc&U\#2H ]RQmsUI43%_q$ǽ^c)"*!(k%n mUI5_qÐrꨊJ)!Ъ tg*3;d786pR9'(% dH(jJV5I'73'ouR)wcTLN6?g tc9e8h߆4hѬ}u5Я1װ_Mmkk[Z˪7Ü?'̿u7T1_>as'[_UHQv_D9+WyOQ@hԖuô?ͯm}ziK_ҫ^55Яjky/榲kYuF5X_ ~~?.buXhѣ^55Яjky/榪?[Gs0ТҞ)Cwg\^d"xA K*zJ33y,!aq̀K_7 ڌG,rɑmuwS*j Kn%i:mk{< ĬUM.3q!́97[ m i3`dۭ6 '^K<~||>T9w?*rY{>==b_ڥ;}ޱO?,i6VGV;o'Ӯ_uC?ۏշmqc\rֆi4hѣ_C0q"OC۫'Z7n<ė~e&iS'/?%֧&i>s1٧sXh6Ŝξi5w~}7glhBJaԍƿiۧ[v F@AUxSPW9ZoUɷφmxok_#A_9#?ۋukߙ .篥oxFu[?gJO#^~wO>z5aU?U?Qה3AEEؐ <:/IoҊ Su_5]kkOXFu&{Ⱦ[OX_>EyobKk[W~wOF}8 p C?3 ٦=GE}uwlH rRpp7ѹC5 ьyzLͽʣ:㹜QSëLvoD_5/_V\8m]],[P;Z\Ki1%*UI"|HKӓ̲52q $dh#~[ 2]=UD_=8ܿ-'2,^DƁovTJe.Ɍo "쒎B~!g{&d80y,7V]cRgFiU ,6xow/e_N峙mzﭝ6N@3&#Fl* ~|$b#њ)6!DUO-7r,9ٍ,2̢<7MdY1^p=3z3VS${BR"DEUWtW9 48y$g:ܕ_/24.;"V3Z{`J> i酯}i#3e6!wCCxcI8ŲIWfrTkQ 2"+~*^!J.OɠQ*뒣^Ւh1U+7P}TҚ{/kSZFlc F@c7#8VD4d8  C/f >n.C z۴h? _hOOFC z۴jGg{ٷe^Wyv?|ߌro/-*Cgҭ GӪesϿwCοξ52k?'5۲o<rv?eo $BVݯ}<n)tsCKʸǢȷ5̗ZV5"H"Im4k]'wgT@L/Z^N&En$gTҶДLB Śm75DٷLF俤{TVv||` HW9~92H~xĹC@A"q#_i&n?i/6 񽨾)?gt r%*gm~Q=,aVcs1}RK؟rnP S[U&l,22JuV݂O5f;lrGj1z%?͕!qZgitQUzۮϮ_?w&/?.iQiznf_p n|ksXo[u9Y3,zcG`_j_z\}hѣF4hѣFGz?weƎwRܫU㻿c5K:,7M>c_{wNG8vittwO;ʃӥ܍Ͻ'|DvcO^{GٶF'{`{L+~/ DF(i!,r%d 6[RvEC !.whs-Riqq,gmS] N?T&K>uM"HgiJM"k vU}_r-Q̩Xii1XF b0ߦة.;iko_zpZ5'W ^V}d<{f'r1q=\NNHhQk@M_#s#v]l8&MuLֆ8Rw"c" Or}[D+ѮI!n}CҞ\h;=LM?,R'PoNʡ1EX6-WM k 9/yƾG(r!6m[/%*ʿ̾BQ5^hNMkI 8W)&3h~`$$n8"Yw"rep,+%_i)?pKjdӞ,HFfۛl]Ӯ*i"w0n'nNo⫮p'3U˄̼!Nf(Hk !  "(N&L)1CIjLYQq1Ĉ@/! "*.>l)-.]#M54v-? ڙ[gsOg3Ja貹oƒӌH{<< ۬Ӗۭ:(*.or+e9;a͗{4e]u qUe]\ " OBI3IC.*,Pߍ&3Oǐ÷<Ѩ(ڌui3P֧9i /x]`|]ۯKdl/KHNdkB$E_ M=rs3I" 1{E2(F{Q(4)QI:WKŲ4Ȼ ϽGd"OVv{Nu{Їdw؈\G`M5HWNM>í̓ы:ӂۭ8 n"*.鯼Fmy^uZ1q[pPDQQQU] EBD!TTTEEE<5m}L3&3H!ߏ!aGy[Rm֝lU t7?Gk{<Q;""d?uh_ݿ_fN2u=FN4kO uFĆWGTu],s\hphyGn &1B:D#*[V~\u㯪x,/J w=943sb~.e7:LfUHNY%^DLgQq:AEcxl&HҸi1xi WQ-ouR|k_3#c!MzV.Қ{!O~x1ɂ8'ᜱǺJL.BC`_Pa?QIi !'~ɫ 4h֬ ̲8dN-@b,8dffiX_4|n>Q#PY cKWsw7UTA]/ 0F?-"Q#PW5(")"ɉX$ޟG&DO'kO{ڍҞ>k&WWG1e闼TnB+)9BX-"N?逢 *ZLC8R1`\8kg8J֓QP|wMWښ+np /Ibq|Hhq֦_*鱊SNx~Һo_|$zd]t <]| >T\_A`ػp.J3 I-r$PE|7{ͻ ̬jb jܞ3h#-i_T]St;^N{3qfW:7HIȪcXU4"$苜+W_xy/Z![QAlnCҿcG@_wGm]LPQ ?ξu@5v>\\{.%!A^L&7=b8sT/+ Pc("x%$QvF{{&HHאrIspy/u\h[9K-)"N;ey7Wd+ȉwD@//!p̯|`֯2S3{؅_|U6\fr XCRBQ_m_MS4hѣF|t'qnyӂx<}r6XCșpF;0`,>5ê}6s>C?aՔ~_e܏ԿٯYM}hѣF4hѣF>?/?Ɇ3TYF_Tß4n\.uk{_t_'/8{sӻOG GYW{?w^YasGi~]6C5%k4hѣF4hѮt_\u=\zL"@C}Q\6*j"]aǙf0nSj5F[AkUz- H Pbx*ۀ93#<]^hMկoxFQW r&縧`Yǩ\C!($,: I$"ES+_.:Z O=܇njJV= | 3gqF}k~7_t7NiU<:/u_iuY 6IvSps-Z8Y"YUTC:=(JhT"WwAܧ ˚Q:ō၍'SrotS}Sd?_MڵΏ3vCN dlq+\-2Ya9 Xͫ]'.鷆9|wpy#`bqxƍ̡yy Dr+Ĭ#VMtmey(ZT7lX%z$P/wgS_$;?z=w_Sph3`q?hn5kcݱVĪIя~?E8w8ؿC:Wֹ | rD:c//5{u?]a] wmŊ[/PS~?Yjwos{84ΞQCNknizcrLNsB;]Vsk"qGRGfNhܶ5s50hѣF4hѣ\4~5dͮ9SBbqyt'U{p2D{ZUuz]կOw*1_Xa8~_e܏ԿMXM}k4oK^'FJ}Rmnk64kj%gy_9/c?ד+u4}nk4kÍm:n6n 8&$+*kɀ8ۀ.6"" 쨾 TEEEDTTQ|QQ|Sڋ͸̼̓ӭ:nn****.7s YύI¶"$2lB7cYK/Rb{-"%q,{c6>%s(s;P=ޒW ^?c/:ONM,mqV'6 )O±gwǪLA(H}~E݈wWsi;|&LWzzq\}VcCH8vkLŴuƯs罫Fc|re2Q-#QXhJgp`%IGyaGZ1O>8'5"`q-k8Hy,F]=Q"g ]+.lfOLz~/s2׊i{RXpPؒʪ"n%.xd}rn\Sɰ Z>9/m k/ݐnWyXA'@pF--V }|9.ǖ6卣z/c`H7xTN91u']Tۯ>w'w9ud ;>sJx="D=O;):{u}8l'髎zFqߨνkȉWČ.:C ;@km]pXML5U\>KYU^yH;_ݷ&U2|wusIuL3??ZJ2VUUMSM4h_.Y/{hήo $_w?}qـ?xz,cjWu{ "'&>u8Kuy`1.c78"FzPITׅvMX01v5\^Tmd0|WۋU[|pb/8mMC%qT.)W  a":yOg!9Sə(2sw}2? Ð,ASA7Yu~MylxBƼOE'7uR">-+AKK"N4"**܎xCq:)H|D1uT)dk#s9ߖn.NM7_DZ`<7tX6h-DR%즺_BZ4hѦw!g`_$gMcVGadoF4+i93$:-ͱ.J@E_{?J{v#>o?,EHˏ)q׼.Q\T<(n( D(:Q ϰ TWʨ&U|dӫq_uc@ͱpSs$ݽ}DléMNxUSK$xx35u`NKD^9.:КpʐBtZ+9WI]$sG$w,[k]WHiI6ј (D!#q]4Yw"rep,+%_i)?pKjdӞ,HFf\طOSgjޝt SIu˄̼!Nf(Hk !  "(N&L)1CIjLYQq1Ĉ@/! "*.>l)-.]#M54v-? ڙ[gsOg3Ja貹oƒӌH{<< ۬Ӗۭ:(*.or+e9;a͗{4e]u qUe]\ " OBI3IC.*,Pߍ&3Oǐ÷<Ѩ(ڌui3P֧9i /x]`|]ۯKdl/KHNdkB$E_ M=rs3I" 1{E2(F{Q(4)QI:WKŲ4Ȼ ϽGd"OVv{Nu{Їdw؈\G`M5HWNM>í̓ы:ӂۭ8 n"*.鯼Fmy^uZ1q[pPDQQQU] EBD!TTTEEE<5m}L3&3H!ߏ!aGy[Rm֝lU t̿F_?SOVI5+]_2zkƞӒ7_ k{} ,Sn&չ?ϲY_~ܫ/]d7F4hѣF5t{4_?kcHyșzfAoY̝sQӯ{GԯWh(vǞSlk]??/W_7b4Dp}YXm9urhѣ_dcm`DuZx(;QWTכmB6r+d+˥QG?Rs**Ch(mOkgMqSN ݿ>29?iqYfbr| )+R DMv+5_g"^?{{Lgsg9tWP'HD\(mXPU7eDgɛw6#nc}'jڨHDMb;ḩ੫&$*ik:XnM4EDߡ{oU:=0}lo;=l`mZHR7^Yba7=n+U ;BΗJ"]MK:^eλy0T 㴂 bVS_Ss z>*(d+e%ȊL­0نAI[> b Gs)TQUTwbbS+R8A)KRiM#dRk lLYsekQAlԙUC)p [g5V!wQ/M|w$^CTL =u=&NQW FtVd!ZBm'RP>P9l73D8DpU:~Col˽<,axV A$`&hXrtQ1TEU`3lud(^MpQwT"gH\ g |Ëi^;sFo$C`@JӒaNSnZ#5D־>M~ȖG[f!Vmyt`8n&""}8M#2[<7}BVl)Nȣ*/Io"%#Nx%ƙUM _җ,?+> >8ŲH9m ǽ)148Sq\n¤ !lOO2a >c'U7gM] =oygϿ֛tԄHTIDHU6TT_EMt, ID 6TT_EMIZ"lBB "쨾z&v]mXuMzIrGzQՈLy\R#B#zԺe+>am8dR >Mf#XK&CKgnUp /g[+~|Ƴa(ۦ#m"xH"C샾W:@|^U]&͖1^ز1<YtCݛwer|WPAc91Ϋ| /FqzAQuBBeΕPME}m*zL&nn>Tr:=A4b])+q lw,YX5Q}}>^\vK^r #Ϫ⓽Wigj"Qs~7`wzU[MV-W}6uLuf(/M/bݢ_![Rq9p薋ZEr؇2`V__uZnVn2QZqKKYob̬Sِhe&H5= zo_g){<3B+x5q77 NOZȃ¨%voсxDO%rc w&ۈkS_\slKg^c㳱r byf72x[FmI :~suW|ߍ{&6!i#y-l=6ޒ\ح6(D EobȏF7[(/ْ@;!q@<Q<5|1!6\Q5B1%dRFPNO!\nM\C0qӤߤԉSXjK"fH>igO9o˿xɿ榶~ŧ!/{N7}\oifY~diY~Wera4lC^Z^?6c;i*S4n{">zkyNVyFK?f+7Fdˬڎ匙&f~*":ԓ2\*LQ ꂮ(Ѧ_Y ɇ3=2e{FY,1sv<7fv3:D*^*鷤 kiy2~yOm)( c .={0 {KYD*+$P7/)E|6s9bU[3.SvۈqfJ׼q}pyy|t.||^_n:㈈_la/nu *}U(&J'ҿNf񨀚l=^'*'u ȋ忎ߕ~~޳&4kf+`&H=BOb"*С&ӿ=kɪx}:SEBO%ܿ/׬x{m}e~Mdsy}~^^{'ʎ.߉=GY}?CD(VH[2%]UdOMӞ$:'I Y2UTUAUdS$kcF5pi0_'f='44w?Ήin7uecXF4hѣF4hѭYgg2%umtI,'f$b2r%̙.AXXl UUu:t*S,E"t5Q7L)mc0 "k#M:n<L넀mn"""ӱmm:]]\966VV2Y_]_ 2tM!Ď8`*D>~~]wSGqaxMqev>B_ݚ9&yZgsq7<}Qٗ$)w%SaQ_?7O>IJW俻UHpOUIqWjxllN$K;i#%ipSЬ2${ϙ8#_1K$qo8-M~\m9,[Br^H'vj"HDVXidP7u7y+Qi?WY^6?ْϭ wIei㏜̦:;n>.3l#A2?Yϭ wUe붎Om*>ȍY>C~1]q;1EQQ}_?oVIowaKm 7Z5g6Ħ=x`︒*"k\'y .HȠbx& Ca9 Ŭ`;&\:Q#HL` NB8+8Qk4[UZ?!MrDtlGd~K 4ሪ5=Ak_IM #($Dr2TR%AE]0yO0זK&x1m3ciJy0~:ȮccSnC0#: AYT*,~a=XNޏu-I*t+~[!ЃSSB8x̳AN_w2;y}uژ )}ЅWWC&q2 " N'0L QuE@u*'fDd*g.YXZﻼYΗa%z䗛ˠTTTj,Fh`"~\@.AΙ+Y>rieA55z'#GL{҈fw[/|\'A,6ge;Ob lǔY\-eL ww )k\Yu*j#XR8#Dm]K'5F]QQD ڟD1>2zBc7YќyfrdBŘX%S*-]="vC3usx9ׇlIoIۊ[ m kWnO n-AJl6$y,i3W-nKju=6W#N:knlɌ27y y }4_!dd^eHY@yM"pTH@TD 1 $CDü^﯀1.BLc!'mA6 յ,˯54[nG%GqtwYv(qO)fX}Uђcm5ݗpʎw:zLUQqweWڇr}ś`<#ə~'u5tX#kiQam; :0%sUk uvMu_U>"Ig֌25N14tT]bﻒn쫻[kվBNyw9rjn>q|_e= qOK-N].Qg? ]@ HR|sR?Pnc8\߿T HRfPl?N].QnqC=G!}]>Kj|>l0;^}q\9g yOE\|bqG i㽼yM)}BWLø.x#{[3qLJ(>js<>8{xSKp"9Áx̳#1Ok8S>%"%Ds4}}eDT/+$'wsq߯UZr lH8ٚ>#z#𷔑_4T.Rl _aZhѣF4hѣP97 ]Jd_7EMDػ`?] -N&EQ]{dd_Qu9vJ%n?TЉIw%|*yDRUUc%R߫}yk﷎ӯ=e~MxTE?L6o¿^ w $mTׂD?{6@_*){Wo-{m+u+қo7ۦ$U|Ǚ촙!a"S!5'-L=T1EEEMѥX]_#ݢ}͜wB USfv)*(1;m}mM[$$M]Q3u7)pT"+awQ3YM06'"#SֽTpPQ?qUadNIu]Qq:; Օt7#u&!$Tw^k`9YyC;U. QtAZ]4򎯴ˎzDE6QDuOMog!q'$|M嵂"M{$OaXxTHMUQw>D+.*ʫEM[nDKA=NUDpQQU̖Twh/ TwOw>+pO0esOsFUļr 3&bPҲa :]jR$  (߇r3|md6uAF֛ 2ku|=Dv,zˍ+*g8gʧ'ZFD ^Tr,fK&+mCz` :ES$$/_[yGם.0>Q~Z+j MiBmE`.6>:\ih TԘķL]5 AUDAO|u#.&dO`zܗ(H >*".(JAU_gПLCq1²4b2;7ܒ@)oexŰE"DVvsYh6/OƁZ}[]ޒ- HhtS}ԉU"{Wؚk0L".5q-qewRɱn=$7fVJTŤj4p2 mE1rM1"6Ydw!65kn ,zvZhQ5|k˜Xf}iت*㊪-"*-lZjh-5pb`PPY3q4"(,x"'+5SW0jD"5-Ǝ Ͳ''X'Rwʢc Z J 0a0(fSdD7ί;qjš2H4by=o:S⻉:Ἵ*F_47wQʱ#*Rr7rA/CJ(B5 I? *k_3v/;{ {+_w;\k0ElA,p7rI(*8|k&}H| y Δ\YȱE qx(I'r")":P?'~ϸ2Ä-;:Sd>",$X ׂTo"zH#RԨ8('P/㯾_gȨn{Rȭy'{i L6sU60D2 ղES}DZl.&{eu?GסSeUסSeU耊)y5&scs2XGuP9v&/;W$U%2VeAD^pAnnw+ΰ,W"Xnǫ EJ̣HS:cJL6KTuXm8EXk5w0YVH+m[] E|2p5㠶@]qKԏg ,!+s'duS]%5m U6h.~3pr"n0LoG12Jۉ8"/Ə~"w5T^cQ5 pjZ `@]a1Pq7GbB$^qD{~pM͟3~kVTl#i.-;b8m7"a$L(Bj.!YRTMlkKb3S?M'?s2uu;? ܏6_6@M_qƾT~grO 4Dk"O_wv_b?8k\篲Ͳ xG8J;Zg⢌oԪF>@׾;<.!pfx.O#n憎%_pcfOĎCn'sYA.-n|mgJi0hA7Ф,b3{T.lq# xs-$ײ6<[ AAP7SP;b7KK 'ăp-z Kj)j䣱8F_Y΂?G0==`,^?|Yxv%: ^[kS1[”1KUw-MlR-o)2qA."*'Tx (g gx6YQYdYKصWYK8qk K]E*Pf4F~@CrKLN h##_Q7:7!M6>)a?օ-0 rh.cu2q^8B0iyNܓћn6d@f* @bH$$*/.`m68@`b`b$$$BBIg_6.8͛/2fӭ:ۍ8(n***"ˇ;༖TMw F:A&LP [kioV qQEn7ljጆLQs& z)$sΣ?HX/}+@#oԟ|uw>n2>sI9gci<2ް &!^^BAmBfB_r4Ol.'@_=&wP'ܟ_]ئ,s"'\K &6䍂' _2;VUPj:zMo_H~~]=&{etzMЀ)yЀ)y@Ew|uuZWDY>v_,w/eS^7_ Q<_Ү>Et3:!Z+:x;NgG?gm}kJZZ"f>BKn55E%DUDߧ[;{WYWoblH)᷏bOB}lx֥M(3R$}ܶAI"2 "H C~miM ZAXa>f &G,c>QQQP7m ̪쒕` LFAՍù d͹e%tz#*?*͟)k|)r ˋ=d7&:o/2#/ !wH).+'%]=.YkmuENުmM~ 53Vɓt5Vퟍ( 6&]$/0;8]d1?Y=GuMMMML2#elp P,ʲ>o;xQd2QǤ`=MVVXY42/lbH9**"o/G+((!fsVSYfic@$a]s#19#i%~,uDDO7q>Jı'c.?c]ehaH~eUm $BDg1ls7Ŧme5Iĸ 4KۈHrׄwUtV་fxWG@e^ 2/4KˢM! >bl"{41lM{M5qJ)BV;ԥ>??|ۇo"$5U5e"jn+K4Hr3⌶ 緒aݙ/cG>caļ;\_aovӸ 2e8ΫJi럝L1]7ԝ\\I.Ê{x}f!MæZD<[ 8Msc2)8D"K&W :ږJ-.q/lv-iC]}eļKͅ|GLX60~E8 \m T|udwq筯mFLvsB;]H#SV|τ%=Z[FƯ.7?1F߫o/g9N&Q5)!n[mm53߫o/g׮?m.~_}-~e׮?m.[;R,9j ؄b~3{dd&utrT4(\0 [ט*E7@][ltbM`zvU/6^!^H8!E_m__%1Oǯ+^1gqv Bc}2kZ0q¾$h?x !z9swcڹwcm]_۽\^rOˀʮ;Mk;v?Y1yFU_vne"-*ӻRTQFo㳣ؐU~yOA]}=rIb}둴EWi9M$[K691PTfn.Ⱦ;v 7q?i?ӌuٿg=V6ӛ!1?tƾ r0Ӝ/|U17pA?brOsQv]"-T#=Mw-Oƾ?Tt/g_۾o5_n?GisR3.߬cqSk>D l>NȻIr{ Լ O`qnRX9{GH3 #Z;U໯I'[/m_j) K~;c; v\ڕ@8tVZ=#AW'EȻI|d#L :]ukw7Nr>њۦ+9-WlIMкbؕ)~>radvqE:[on O5@BOM'KbTDW.+?lQ%E`=ߩ u{{n9$A >ck`̞)x& AlJ+MKz5dɮ0KEb_i˚gT^gsۇ?ٗǿ#>C5򛨿_\s}|Vés?X59s_e4hѣF4hѪޏ]Է*x_m# 0n΋/SOӹ5𝪽定|?N~%?#i_I/Q?]מ1F5mi鑭yq"ϋ& ›!eeŐ3"4 w5ETTT]`4!̎ĸrv,mң>4y :&<Ѩ(B&$"@BBH$$袨)YaZBYg-uYl+Gf\)ХqÙ@8ĘXpH QQQU5m;O85-o%>}-nI*=z-Iu&ʚqw)|bwx!>x.JNΤp+H=V󫷩*ڧcH}͔EUU/EwmW@V4-2pdxrX38Nlobyzib$/ެSTU3MsF5ɼJc_S#9gq6}t_ncf_!ox$-=r>ی}W"P!zlNz\U|jkja5+;~>|uϑ-Z^ xZR\pM^RD3>]"NnZ`l` Pwapw#r+aWAd?,AmnH{anSƥƸclji4IdG""'MYw/ʑXA*†tb&u&]7uuTV/OrOSw_l鳒Siƿrck*'} ^4/OrOS?>=g$ƿrchUa?\jw)vYU+klJ4Y㳩-}3dYx * ".kO"A^LYm}6ƆeUJFe]Q~*4wt2 ".l۫8F4'v9뎴&xu*tk͟.fs/rK)x"Ĭk64í|+LnSR(B *$BHk)=v1&`+ĥ'V2!*LZ1J !ADO9Q9^˞ba 71& *JZqJ $!ADKv}H! JrȯU_V(N>\r4+ηsK8e:AĘ& B)4]vȹ%e=p^u|VeĘOZ-To.s 1]/IAQ%N3^q<5e I_| (հ>ގeσvG eDQfc8݄&OǨK{Օ2.mM>E7UQ<V'{,㖲~A^;g ~A~-!RUx͗ݴձG?F,v liGfIWZnj/jam[ZLҞ5UȺfXf#X?Ox^+Mڋڇ{y֏?)___;4`ԱǜEEƳÏ8¶Ss 6sgٙcblNq#ERf gWuKs,ญ#cMz Jf\$]_SUR5UY_XۦuBM bfjs~~͝WU6QV,-lg1=0u7uTy۲.D .s12') ?^LvAE7C]|qj?)aFGgf\)XA1\Ee]|4 >OK,v3;%?BjTI8侴Vb%|~ I⬙g-Q6ʮiHƐ{,l:vl|cEva m]'U\)oUtleU+4ZJjɘj}bt(ѣFsmgnrnoɴx6e*0m՜NLkzd}e!7[ކ꿁QiAfC$ce!suiiyi]qZpTimUBEEEuMی`Yvw??2+N@\)|>㌀$19 jí&脑qPUr2]tȖ$t,L.3̈/ǓMxQD5ė&ӡHz$RTw IĆCm]!$TT$EM7@ͳ"Q 1T!!TBMuQ'TA"βdk 8NI.+ĈBTMB5Z1敚浓i\6epLT&W`Ia_s=?r[!j1ѴR '}@~vaHeW ȘʱۆUיF=@""tCBl.\W/2v='%0 1ʸ,gRYe_@jϫۛv SIE[:s mUdWfXL1F @UWIֵUvWw3cVTSW̵;M1Ed2_U]cy棲 2fΚm6*n8dD>CRbtVMiƩ @ET[guTlW549&Edi0|n$|{KjT}RS%#/.y/iǕ4[i"?*r_iݒ2kk$NJ;'A-{|uc׹z\K8q,!mmA`͹ Z`kN-rlRp ?)cFed:ټhLhN:*: _ NΒM4!d"&$D(D""D""xƍ&l~\o,X82_pZbx~?/k&oQ;._A{}4}O&U1MXn-8֜gbKE-" C}vaec}V•ca1b$L9&\ei5?a>T v2_[L.bÆȕ!i"%"k8 㮒m8ᗀ*E7|u=-tkk %mlgfN ^"d"qӹ[NAHnA2nJ$;˩kPڬu6Њ*& &r.r_'N78ɲ X.-Lm6 h(wYͭ]V3KD/03m]M"9˸ǝ휔Ros/EOJ85KDi2dAPSM:2R #1F{' 䛭+%5ru$00A"]{.7m'ĨېN7mr80S!֢b6[.kZ 9bÎItoDIP7]d;8)Tn؍#2\U>3;B~4iǀtpiKm㼿eN\c]gh`MSKO_n>??_'9rw_l鳒Sh@c_i10qi|.nxոo'*጗$Qy ȳL;7p1c0vl H`'ԂH)/ϸx!,$lߦj&}Xݰ*8F-B8X.!R .9/ؽ<ҩĈL#Dd H}ћPUwGy)ɹoJƘ+-们$|$ Y~QXu[Ѯ. 6ΤD-Ulj.5Mϗ0G%Ϙ5Ĩ6GIz5B@:;7\*(ݿ*%_ s/ ͔]SgQl n" EnJÎ )7vA.-)n6${H'=N(U~ַ)<<ܿl1yo!I/xs&fqIDy!"6jE>?7Vݿ }?$ΞQCNc_{wNG8ewto_;GʷNӟ\?>]~?2sF1酣F4hѣF@&p,mquSX3_]DQ?mgsۇ?ٗǿ#>@ת}&sL}|Wǫ ,ƥ'}jkY RZi?.5 ?W^'ҖksYhѣUn;_l |V0ۘS%KQE{3.h%&劬h"D*/?ܻŕXS=5k6UgO?&*-%6E) b ͮj꥘̀9mYV\C/0jM6DD-s܇5v3T>O{XMݶmc95COveMۓĊh2 21u/AEar $\#p褂 dYdwnPJ ;ʅ֢rU.6)}UtA x+܀"ؕQKl\eTyvG [Tfkf@=&D}S_G-ޮvn12ˬbTYHI\y-ve5k1q4g\}w80DgǏE X5Ѧ螐U^AiƣL1SFVߐ36mZA2[H\"H8QD S}5c>N6\qv}!3^̨X`UɃid0I3m$Ъ~f3Gd+g_Uڷ4hѯ/FUd=Sa0\_+FPL0b#&Hn3;#+ MQUYP/Ns 2Tm=܋*f+&HF8KD_MSuFjLŕی:`l+___ >d8;*4n60G!e32L@@ ԼB& ":⦹g_9F] *3MITjnU2Dl*|%0 )*,,3[U!:6mvUONÑmD"fsɵ%DVMN7g;@l*2F2̹Ӕ2GM˭kI"lKeC;%>;w2} qͬg[OƟege9zDy#2RU]X;~;f-/uૻۻWVGY[[YIvm}gx}Lu""RU]9ıY/;"F3ȑ!}]y57]uӌF**뫍ؾceweݦ9^Ssi>G۟d9Cy9;<:UͽdJ!DJ'O_ji;Q{P[o?o/?)__o~^Gvi? Q{P[o?oM mx//0V'!}Mg)\i zI:szU :LOἠ[`36d0r(5kI :JClHtZ5R5%|Nr> -8PbG eɎc\ON156sa H؈&q9pMb0qo].gqt1\NXKJ3w)%ƿmSX+)L>43]pGuwm9UU_ц`#\P5d|~"o3_TZZѣFq3mgv)[ly=]֝lwgb|[ai b!t$>::??:0 ˚m8 >#66 ͏uټ#QgXć^]) $8"jJVDzmb[Wpm8^;u!K_;ȚΞ/x- Fi'̯d}oGku_YL"~Ljt$aO|뿟dw_Q\`+k xSfdꈨȺNPRmto󫨯E6$j#SՓV$QUO`*/ҌDq-}LrSr랤#NDl2WIy**|cmyP*"Ux$-=r>ی}W"P!zlNz\U|jkja5+;~>|uϑ-Z^ xZR\pM^RD3>]"NnZ`l` Pwapw#r+aWAd?,AmnH{anSƥƸclji4IdG""'MYw/ʑXA*†tb&u&]7uuTV/OrOSw_l鳒Siƿrck*'} ^4/OrOS?>=g$ƿrchUa?\jw)vYU+klJ4Y㳩-}3dYx * ".kO"A^LYm}6ƆeUJFe]Q~*4wt2 ".l۫8F4'v9뎴&xu*tk͟.fs/rK)x"Ĭk64í|+LnSR(B *$BHk)=v1&`+ĥ'V2!*LZ1J !ADO9Q9^˞ba 71& *JZqJ $!ADKv}H! JrȯU_V(N>\r4+ηsK8e:AĘ& B))|?A7&}?~kO_9Mwqީ/!O=#~2py5u{(Ӵ2p/mkxg5E*C7 .^Oyf-ɹsr'cI%նsʥ}lfzCT!~b 8bDo,X?n+]߃vyRJk֏U%"(ň$4ӍL-é@rI=hΖ67FAWE]h?~'zs/ ρc]OqNiKϞ`tq%1׾c&Dx"9 6s\eO;L7.̎ӥfRmln;2Qx ,rܟ7&I_:V]AQrTQ5C'Lc2\n+zTސ:mE2_fg%rY˜yfwY$eu8%cv.e{4NpTD֦->9mF3KU5Cכ>[mIWǮr솇`idUxd~^sXQZ\ D3dLJzLٍ۩pZid7 ?07%\.Ecn'Gr\%%L_P>"sLRunpqG ԓNdKeI[`ܑ,aSs8v>RciIB$6rm그7䗸t'nknjF; F ^Zp?k}woTfql6Tjuk+bȲGe?5]O|?7&U~kO_nv/Ŷ ĀpU9x.<+w /YGO|,VEiBET\6OWdy(es%}zKQQWK 9?oQĜr 3^÷6V-wN2-ڊQd 6D",GxxYb\]i!?]8"HȓUbS.6H*G{Nc7*_BuHŕ\r4WfKF"k6. q>3rY/ ɳDߥ֏p1E^l3n1 | |>{Hrjlh"] g%6;!"H~iGRޣ_LC89zWbX9cUZzMYM6e=礼cI)rF/w~i5 cE g Tlq4OM'[Dm9N$Hx`릨 J99/>j0N,mRtخcxU\ظ,'"dx_˗y*9K_'%[E̲,͵w2 I6_M:eDO~Q W|2U2ܮX#?we"0~)yeEE9mdťfHoԀR'=1]m |<5r~932, -neq]cT5(bmDM" |F"̢ Q!8mm(nJm"Cy6İ b2ȳL ]b*vBҨ "|sDS1]}h:ETRW؞:G^19x0H%evk`$mSWaj2&! L 6q~M5Z\SBxs{n |knwߓI?"jq=L/}܈#O4kfv[\V<s6;Z3dhslܢ8!b4] onI,Pףȑ|0}hQAIEj=Q 1NWxk1T|A(k#4So ۯ+/{*{1o\Jeoi&eҜ +p8زLJ1a 濞4jQ_i?_T5aE¿CpZr-t'e>=X|9nw,<ÛMYIꌔ|rTw"´JT۬"|K|9O_2%FB}[J| q&fECmJ)*%{[bjl4G]BF~+:Lտ_SϿ!!?`v87#E>Iq$XuMXW]LMCN(Q7Lh 1m3pP@ȗdDU:7 l !#3%AR""]WLEUDDUU]UW=M8f4M88H`fdA6 9rmKIh΄oIFQFpzHe^#we.IG fUc2<иQe~,$Rq6UÁs56J̲$EP>eU7B?mm} SĘ] s(YV%8fշQm2v_'9rl}{yIMa,k7-?6UO47j=埑v?9*| IXiuQe<7"MWkj8Je Q }Xܛ{86|n0k69lyx0.G>=\']MTBTEㆹM_>S;׃MSs^ IrqJB1S .UCQ V~NwP\r 8wt]E!IPe*PɈʖ5GnK7PdT_ "M_  毟ӈcUsc`1q81Sa$eQ$1̃'_Z:4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF4hѣF+K XOn?у^_['7/9ʠhjxX_jڣUoK]wCm<{/5}u2k{ܻțl)^euՈHtU%EB._}spPM]mU|^D|{icE !E7#hIzWuti}DܑGES>w_MgѣFnBkPky/榳1׃]*k.F5[1_֜Ԟ1-o/[Z4hѫO?5չ?X񦩧s1tKKu_S-ť]4hѣF4hѣF||gmCr$;[&?ry]CvVIe1x~s$x#-FV̈_.=_0U¸샄o,XF;*4Z 1"7WiP\mw f@""vk-^Md;{0$ //4IǦ${-|ttygnL'qkcwOpVS1D* ٗQ_GHY=`?(x31MǬa`^GbxI%JEa@2T9EE'Y)KBRCAneE$OeAcy(:I,%CTH =1)B(JHh7ūj%ҳ-m C>l0.İrSP]}8N"6*o\꫏1WƬqcn'gѭȲ<*=eTǢ啫%L`8 ^`OWn! Zk{sZ/gR` 5rVwk#E)r3L2:TZBˮJ9MDSM<>f?7&x[:ŏv-dMdŭ$t\l$T?O ~eMh:fXRD/J]87 *a _"?YOsoV2a+;]3e,1\:?J3+,2sh%Rq7T q[+0^ 乎CK㵭 j-mUu{cyS#|br}j@F"rKlUvE-ttZl:B&tljQ9TOFmWk 2Bq<r+2jChr[H홨2km"qyCym2ndy9hC)Gä.i$z { ƨ8z o*yIچ$ycY%N{7[i MXAn¦{8rnTȲ_SB2 *+f0QK 壒mQ]Vd4i gsEx&O4dz9&瘽,#dD4EjΒOÒ|SS>w{wF ޺0y#y[$i&c[9-D p]|ۍi}\r inh;RE]8JL7*rmHY7f J$,";El͎h A^|2wڕdWlݹ^4c^`#aY]~S_*Qڙg]DrSMVݵb^ۏ{;o% yg@LV~ 2NI1H^seMͅ؅U[ΗCǰdd0gB%i1nԡR%FVwǷ,Yb,3!nn!fqUT#=]vnxӼ|KR\ ֖Ӎ_]'(`x=3NQGJW/7yb<n?̿{'U6M}y&&U.93D8ڳ [\%1?NIC -vqp|s.g5NSUoNQͰ!^^IjϭUެ׺=ncs=HZBUeG 5vzĿdM4`DEwUZsٯ{_s}')TqeuX|OԾc.=Ie;#ְ( mE_-bwT>˓~$t9G88Nw?Sk"һI?9ӎ$JͲ49bĵExݳuף5 vڷjs\<{&U-ngq͎5)j8xx04n*0շ$YͤIg9+ =P-UeRvwf=w&=}qt]N}U#1̓' wk^F#"R .k:֍4hѣF4jozVQ6$ʻZ{tT_ӝG/uHL=!ѣF4hѣF4k[ڼ'w-IEz^9L`zj/X*|H=C *3[%DuSi3+/Y՛ԗaY0k.-PC,IqQLT@mPZc"ܜi7HBѯO]Vty(e-Qaƭ U"0`jY#mXFD|kz|kK]#OC'V\7|Ul_NWXUJb^ʆGY*+?ENП̭.A y:~&PX<2n07{ғ֎4TV]"{H4QB%=B৐<> HE>gU9goʛџ2vݑZNr^4yiO\]! H_3kW۰XgH$䡓" \b*❔oWiUqknN8*䑐 %yn& ("ُ2)9AEE sڢ쬢&cu*껌`Mi6?v4WUE$}y%x 24K 2~̀b*@$+c.:mk}!Rˑ2PH,Yc$^f8-n9 hvWSw ҇.bﲒx+mQ;}1gfmr=[&o!j,JK ̱_~c69ggig\,pL=M9:˹\.4 =yi v3+|JYuJLʁuh=Ev//kjŸe.Hgf.k(D6*<-O(崠]l rRi^:""C.+ICNì+.)$3ǜ$8>.X]sk^L|{(%rhX}A=*;踔]6פMQ7-ר{.Uθr@c9.g1ٯr=irj&,55$t0 +^ȫ&nX8; ¾lgbT9lnBklrSwGc6{'mmt"N- 1d@bio_;+rL(Ȱƒq\k'nbڋ eE7]>|guDP0T]>8{s*MKǨzG[.+l;Υ SY /!3Jkhu]c ݆u5%!nƞ͔d7MT\1-4~/}lK;K!P[[E~ W}o!4_ah2H$rX[(}c6mXGCmm>p\9mӲqju.kĹA#2Gs%t*Tޑ&CFfdd L.\ RgO%f}2K=&T/"LHUUUWNDDDD<<_ 6vv7V6m˳+*uN;&dْ]'u'pUUWSkݼe.+8/̈́/ADte H,".YfHXew\|W ":_dZBfE$MyQQ\E R+&{`ߚO¾Bjٟ"Ɣk\X >>*/̧GPǀӊ#6LXBO>=1Fm-]D QAFXE3_xTuU]}\{V)s(Or-]D QAWFXE3_xTuU]FE%_j:On!oWT1Cq-Ab u[UE*뤝ndDk'̷toѺFC}Ծr>s2y/2DuYHH1B?|>:?0?ߝ"snyĎ})]Nsm|م]- ~Mg5cį7y17MED_]N]mӆsE5 bjK9R!Aʼnzboᘽ7sm|uK %dErDET1?oNcv?CbU~+}>meUy'W>ZqUuyG3_6'+|EWmgsKfq>_yG3_6;X3.]Ҹs/Gyh/Gx|hGmgsٮi\EOu'8q-b|g";zyVXqƛc%UTDO[n~fu89 T[ϘRڎ,Le:'UUDO֤Ⱞj#"{k_+?*{,N>i&gFGqf/&YFb*5(檪(> l|SBbq[d+Q>uׯ:5/g|OeWA)?奍oݟ߭_ Ӟ9׷O;y'fd)?x%k~gvv~?Nz_^>ћ&}Nz}{t.}Ѯk pHLC?֫?_W;Oyh/W>NVLXkzZWe k<)0jin*;.Q'E+uɲ˃0@D4=&Hv׃M6^ҸBKc+q5N+;jf]T+ 6e[q.H DvCDǟuM/8KS\tv3pp—S3Qiǭ8AG{: MW:&d k~H.>n^81tW]pw7#q/KQ6CW_6\¶erf\] #V5kIB&B-dؘ9$ ^/ *NEG.iOCס\+)κclZL {(YtMVm@֓$!{?d7TQSq]tA$Xx2&bMmLQA[Ifk3:[jY}v>,[(m ʿ|jѨ"'ZGK d<-w /-\0O[웎"ueU&Mj`>ZIZ 'z?iG_YP_/ZH3rL,RƓ?l2rQ9RU6cH@|3,V  \Hk+( SmkI_J{I&P ܟ6-m0˼4Hybe)fYYJgH&zAqb$=tߥUDUOms.9#x˲.ʸӹ1Ɩx>YSPr$bMË֤foITTHUIUwUU_U]pUITTTUUUUwUU_U]+k䠈̈HHw""]ԈwU_=~kF/gNVg 4'r>7m|||5)Qm?ԃӆ =;hsT[㞾{Ln%l|YQk*#%8mq@i+ lSdWja. m(31SΔ *y욬q荼OKƲEWQ]'R'<_Է ՘ó̶R@÷\{**%)qf܅VOsL.zo%ل!$-I[DlEQ>DyK;=$i=Sl& - "Yv[FYiiQ7+p\) 1%}Cb`bBB)8SyR)i`8M(igQț-J*p%3\?\$|o"()ƪ3HEyR6U6]!)*(?ѯ_ڗ7C?~2ټm ]edu6ћMH)1"uA"DE_;y7']|l`Mܪ<̋-x_A5=/25??Y^lMz'md2}>-x_='v_:,%5N^LI4eufq>_~}mwOP\nj uq>VH23e]XoiumqQV\!26p`+Òd$MGW8#o$UDQ>q9!ɱG"E9I1txDG {I7m_OΊ i?qu^m>{yii=&ėt%.EQT%~ }8*o?l~++jN'ste!q` lN@0""So//nx;aEy\ Y2mH6|YjMMn'Jm>{N;iN; [Y r(ҶYT9ۊ! m:5%}|yz)kWRT7ls1,VW7^Iq}s'[qw]|ǹk*ԇ* W,L'1tbTXų7I͸܏>>nk~Z_<]R7SνiIƮp 92 6[x$ i J>pevA\j?p\ȞaS(8lU.:*q\0 uA"Svz)ңlG#uN:D }-YqEɷc-_dqƔx߳[rH}Lߖu3UOJ gmU[3SvE.w),[39;.jl }--cNq:F7Xƪݑ(@m̜q"qqT{_"rsl͔SQ\Ӑf iQ!:ᚩkE 5DO$O_.w]s%5sHŭBX~ ^qH[V?.[OHyIOUDEDQTvDDOU]B$D(D""D""xƪ""*숞zbvgj6/v?K@U q(wH(|[Z\f%rF{6ޮAr@ x9 )$lC^/:ֆeH òyz%^ʭ{ +ʴWNYuNU>]j C jŐa{L EDFz=_x/] ]u>9#A uO eaZw6Eٵj8l)/JT&ꞯCZDlQ$.-B'^6O鵭@OڟBzd*.Ob?XkdS}Am}_ɣ\7qƿÿԷu|ml;KZHKfw}|_]+v~7*ogUO7'̻냞^>b0oO[qRHHo_}nsۧ[1~ U6ޭuofW_˟7a&_z~Q(?s}t|8tZ/˿toɿ=tfq6d.~?C &fѸsOG/˿toɿ=0-뎿%t}؇M6o>44N8Cr޸2_GG/fѸsO]pwsO&f;8R;AXv{Me@W_]}qr$v=Px/%wkz}'6Fe@v_]91 !AF8EDwK櫑xKx#V j#mOV3޵e(Q$@lU:EWuU>.칃3mtl+d!yȋ^Mnl{2[mAQ>8{yoy#md<)̤4\mpD``5(YlAEQ^Y|\uQ}dm9y~ynrPιcI,%jLvlcUGZiD57p.8+30R(I Qǯ»n^i:#pn^eKn6^ViqVɲir-JV-F7r![}b҂lԖ_~qwΖ̬& cڧc͂{~J)RoVHYש!tuiPۯ-]Gvý3k&\~qfqMz72km؇{p.z¶*HCޏs J?]w(>xom/|Wtx.x.?Zw߲lo?t7F7vk"ȺBaÄSJG"U}>9^肌zzPTTR7vbt)YG#F U7@f'}QX/W*+d/舞j"ڪ7M#gkcmk+n} }ln:lMe"GnlQWT׃w]rC1b*Vc;O0d?Wv2`$?Yd {Wymؑ)[ ? ĩE^)K!\vLWw$iOb$UwFހۯ]{﫸/1?|ř>,y5/c笴,݌ܩ;.KH1By@l[9/~"´&XE:ՉK'5=XI U>KZdǖ~K*,(IQfbcRMwY$iQ*!cJ 1S u #^ubpsw]8V pjշ?:cV! 9o^3}w '$1Uh~E[r'2K=/ckOB|ݻ_VykZvu5VwٱSk_$zέ9TfLW 7]&\UURDf}U vpdTy$؏*)3&3.Le$+BH*/ԨEȨ+g!mATQ^ULr%=7k(ƛ Ain$|p-lr gJWm@n7Eόotx7#mv TO~B˷.|I#Inl\JLEzv=:9`*$OgI[ӊE^dzN=wُvۅr/fYĬ{v9_b,;"ojRM%2U|$=t,L.3̈:/Gàm<$$*$P%F C&̸MH*3y : ̺BHHEQT$UEEEEOEOT_UNuMZr+&F .OڋH!01T!!EO 컸G;feAH<ѕ8;uą:>ѦBKg;EG>/uڃGaQiBQ՞8;o +n$$uL䱯/í]Dכ^Sob)}J.^wهԈd9V!TM1Fil?V=. ,8*@beߟ\k|;Ky\ǟĿӗ4QizU{p2D{fSu#] 7v!q9*ogUO?'̻냞^>溽ݓٔS~`Xo|o߶5v~7N_^>tcYCY ꙇGz==zYW_6<}~ˏg]_ɧ_CWޟޯGÇNEn9Coc NE"NTO;ߓ]gٱhAOfq7d9Kи4_.Bwr?ln|Z?g hل9onsM7R.M9Pw&?֏݋|޹~13)cVWli5RK IW`U7Vy'p8 qF#VeU^\Ϝc ylRC UWaU77JbAWu$7 :R]:Gr8">2]|tIslwe9Jλju9Bͳ|tv%Km)>X`Q= YXd"!=V|hѣFӒ7_ k{} ,Sn&չ?ϲY_~ܫ/T_,8waIpqa4۪,~r-YDVL B+͙u  t9Hx|W\GC U`?gC}D$Bţ:RM$v>|E=0VrcE($>m燷\ꯟ +c+:u=ŖxO(m廰Iq֙W`0iF۴4oMޯmpPUuK»8Il82;( UW>WmU/q=YgRp&!_[xD\`cש.SmUWX{*qe!/-DA~) :zqqgu>-IpU[T6 ,wxuzțl(=uSFhѣ_6? IH{x9MQŗ1W6K蕒Ǯz_4ME`˛V[|qt"dPqwTv~7]FWOʫ|ʊWOýwX\Rݨ<ׄh*l](߯&Н_.dfxǝx2t)n_IWϨ5*+ƠdA롰d=Dg҇ӔeṲȟ|;ԫYW5p2 _cば;?:kGmC͌q%v>NTMں#~{h3ǹ7˸)'EGVpXH&$a ̶%E;.EIj^^#4O51?gݞITLy+JP1 +|񵅀Bq/Y!J4D)w>&>x ᔼQ+r+EY/. [M=(mܽ,tYN-[Audn;'SƝcwdzvL7Gu2 ltVdI h.A*XO5ȦVKMX-ư`V >̆6ۖ; X"l^i=+,ӏ1#Ħyc ['icBʪ2*Ƚ DVUӚaa*8~TRJ`יd>Q:j}pK;ײy|:؃4vH@a1n{~J90)f<ڞ3l!ǴSimA)6d$lef;1PuVS+{y9KW{|ņ?Uc-p2'#IZ>z2c6裌*'W;70z?ծ+3:ᒸ5#"&dH 8ʢ\^ĜkDՍlwQ'Etv!EM_;UBǝy&M//JT?VV5+Ĕ4C.fN6r/$Й ]=Y1\Uaʜ}Q?SˈYBom&ż[izTCξodxw$}`uE7+y 6ZqnH` ){2Σ6hl@:(t]hJY 6ZMrܮ9Gv28%:wVG>i#T%Ow\|'Fǁ8+-_DLjK`ßy;4|=VX~[(T11z0ڷ.>4o=EWPъӭ)sg3|j=/Ji&ME+rW[EhӦN2p^LeVuܕh.F(m>Etw7_C&|q*`KL3LϋZ(#$ ۏٞ5q5 u4OMWo>d6'ܳC?>aʻ|uQ/G}||kU_`0_Sq@UQ~?Ϋ_OYw>?SnDv]^{{+RV,7RS~7K߻?SZ~=ojsnHv]H8' >ZSuK~3>1w˥5o͏>_._G}uGi}mӿQk_0/ˍ'{/C`ёڐ.ܟ5?֏?a^[~O!oS FE#ho]rcss?G=ro=rhȿmmknO?ln|Z?g k-.NJ2ڼj$,~ѩORmm2@dWê_/^0ArL. { h"ģb}ݞ f("lKoJ L<- :hlD"***k3feYm<]1fŦ?ӳen.4n6 ɺp2os>¿O,_2_Tß4n\.uk{]?-T<+8Od ֜#9ҫ /?>LC'¿Y>߬ymZ#|lJ*byB4)m@}&PAHQM;Y~x;oʯ잮בrDpk; ^_yWV'fq7o9K4d_6?mknO67>?34ܽ.7Cާ)F6v6Yf>{ߓz?/C`ё?.ܟ4~ @\>Y}U\omc!!=)V:ӂxm{YGzܡk8Q`6x|6hl,Rz_żNx6 V)Ի6%,[=*xw;! M\DۧMu/g/<<qV#7=llRn/ʦ~s2El[ǬWnkuڝ|g(\7pڃK6r] ,O|DHUah*"jr{fo $i*x-Xfbc<,F𴈑l᪠hh4(o*М<dHg_K-kX?1Lv ͖ ˶1Y"DiH"95ӦCZh_8 ״n;o3^]e"8eړu:O/S5dCXeHXZ彲EO' 5`MVȂ:MAUD^d9rn)*mkNV^+Lz7">MFO7ۑ{+1+sMv,~Kx.Jک2]qKM%=1>~=1Q{,YGkؒӳ Aj j ^z(=K/S%|{Ef csTBu2tٕzFp6}QzzdYl 5놃4*:\jߝpFXgh|v5d^(=k`6C/sS)2akPnvdXJUf2ܦ#vC^#g]Q9x5XGeVv?zdI Jr n>D5rcjE\e]V pP@ TDU"6|yc;wo(];Gm<MjnMlzTiK΢]pGWlHcS[vz|?^MLv]u_}Zc!'5if(/M/bݢ_![Rq9p薋ZEr؇2`V_g4>_._r\sɕ )gL1 oD}I5V&nҺrq/f{Ck=V\V,K8̊krDC]\nM$vdc M~Σ t\)s, 3js$)FOXX|퐹ҩKQM/MuS%8ORe|jOZ>Ṻzh]׹U:MEN2՜kQ=.UIFṺt#YFC]>JW8[:%oɊ>3lFz[,~1lUfUN*Ĥp ѣF@=q_g8;l1˩@!΍ӯm} w'sFÏ2K#uq/X};WNۦ)D9Ւe?eY"dݵV{N j;l'mewrQ}HIDDTHIIeEEEE ( "쨨(箿y " BB(lZ.~_D;50Sa9}16ld0!U- 0 jv_w=,UIumh'Ț=b.DK[(q1!/rwО q7MYQkoo.G`uN|>arxe+ԃM1pEVS~?Yk뇻c4I}ΞQCNoknizcrՇKk~9r-Z~*}FD`䖾6DoJ/Q( ;j;N Z cj;IR!Alj_bozb oޛҋ ^oo ݱN2bH]D#!U>ճg;1|F;ooͫu㬻\ݘ\@SN8CWD`?ϑږ{_Wԟu5css?G/˿toɿ=0gȿm˽p+jO?ln|Z?g hمwnqM7QFLwmIG͍ϟG} ]~mGp8_"7 d#tvS#8P9cr GJ;wwYpLJN3_Eռ+,8qbcM?"x'?(/ETHmY2_y݁AA4Aؔwϗa=44ܣ$xbq,rUU6?ߍ3g3kcuSX׮r:"+mG9̾=QU]|k}|rſ?n=3K##~;SnDv]_.;ʻ&SVp8S?S>7[ϺS?[>~i_ZۧO+:#w\k?z)wmuucϾW˗?&z~]Q(?t0}=t|8tZ'_zl]_/S|M9i#uf>'-k.~dTO_D]>?Eס[A$/ .r=5cs.ڏك9onsM7?Y__r׿'?֍[>nݷq_UYeʋiXj:owe_51^lCl-3c-GTARUUvMyb~Uĥ~F5)}8^BzCȑ})qQmBD]Lk™Y,zXD ӐɴJ*d q_4TE4qN%μEɜ/30lcFUO.\fGܿZ3ɱ!pUQS}wÜeXY蠠&UQ!~<_5_\YgrngY2aWrj&3XU}JۺٗxuAn&PZΧ ܨ.xl&>-Hd}Iܟo܇ڿ:woܧXu3qAV#ZD tyZIJcISd*$V$BHB$*$*BH*.a%BQ!T!!UEEv5Ūh_B̾3M5/jܖ[-вW:Qs\F`ץ0sOPA$u2RQ6UwUnuf;AQMɕab<ԕ4͌fVi}2B*9%(sOBY]?L,6\wrLPb$ˇUTVd_Qa*7GtD^Zd[bbu~sFr* &&+[W_EhNǩ[ (?Jyo )(:M6ڸ>hbOq?[gͶ?l{O",FlɬE1HhgW% =ICX9b#(WBrܛ=L&Yyħ&YZJU\32cI)~C)/;.O~D<13K *oas{yk O8MQ3 <},u$ $gy%& `KYRǑ>VʅϧrMs*`M_)㺭V.@H kj~l`w-wGLۋAOH4EE$:+3sx8'/L!Y'֚̋*l ZlG*oI!,CܶE\umpK£M^a.F\ #1U #Z/ z-TT=T|HU|W]dUG4>j3@{A7_jq'/|mTbqf q1 p(R>~n(UF*ZvksR4hѣF4ia%aYgU[♶;odU"tLtPKuc%m4Bt1 15ieV{2!cH%麬IkRt(Pm6;d6FM{v^_bo\Q5 _Ye<nƒ$Sf /YD:)ӈ&*(}v f z=d'XfX-42Id1(I#Oaz]|>wK۶[3\Q!+%|>^9bʬY&d*yʮ>[į%BQlXrv\"y!He!kV! vG"-4ú㼵NA;iRT*oxS#8laEWm:u\vu%WYWJ: N:#"$roŕpL QQQQP 9+E& 2Xt7݋2ȮEx46hͷ16P00T 01T!1$۩eĜaʹ`wR6Y ±hZv.A\ 8jWQUBIߑwSC(Î+1\aįDqQ!i+w nlJ0Q[U6|3֦tXGKeDW]Th0cH6lbC$J*Cxѣ&t@UuF&l~\o,X82_pZbJ88-,%fͻ p\zZQ ܧyUxwW/CΜ;°p8mm?Xcy,&!̺:T8Hpq;*lQgcTg["@ ^S*l&:XC&؈ x{u__>WoWt8{-yQwa2a>Ӈ֍hhJ_>=|9%vqkȒp''&dwq4Pq<#UR5Sl}~^l(q^E{TΥ2MnB񢈹#^;R7w[f]~^l(p82l UC^[ƈ Ruw㟗,ϊV}&[blWY(O6QWzƦ}hѣFl⒑sj/")6c}l+%\/iқƊ=|6E&.M%hWzOgJo\ꍏ蟕V{>{﯏8ݧ%+Qdy T1c8;&Q_%G=dMӡ:]uɯ}Vsz:dR0ܾQNkZTWAȂ-e%Cavzo)ǜse?wV.*kdAaavRu)֏-Z35-KMo}v*uG>]g`g/soqXROX6S`y~ z:cSOhw IWofdϪׯ=u[wd%yۑe5NV;fYěu WIEM5Ҏ~dg|e{x+;vֺSc8 (3JJNy"jR9FvU"5TIȰv^}17cD**(1wuZp^'&|{2/ a{`x{ ũw!ipNAš0/ˍ'l/C`ёxl ]͹?k67>?34ܽ.7Cާ)F6v6Yf>{ߓz?/C`ё?.ܟ4~ @w